GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene View larger

GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027974
Product type: DNA & cDNA
Ncbi symbol: GZMH
Origin species: Human
Product name: GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene
Size: 2ug
Accessions: BC027974
Gene id: 2999
Gene description: granzyme H (cathepsin G-like 2, protein h-CCPX)
Synonyms: CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2; cathepsin G-like 2, protein h-CCPX; cytotoxic T-lymphocyte proteinase; cytotoxic T-lymphocyte-associated serine esterase 1; cytotoxin serine protease-C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccattcctcctcctgttggcctttcttctgacccctggggctgggacagaggagatcatcgggggccatgaggccaagccccactcccgcccctacatggcctttgttcagtttctgcaagagaagagtcggaagaggtgtggcggcatcctagtgagaaaggactttgtgctgacagctgctcactgccagggaagctccataaatgtcaccttgggggcccacaatatcaaggaacaggagcggacccagcagtttatccctgtgaaaagacccatcccccatccagcctataatcctaagaacttctccaacgacatcatgctactgcagctggagagaaaggccaagtggaccacagctgtgcggcctctcaggctacctagcagcaaggcccaggtgaagccagggcagctgtgcagtgtggctggctggggttatgtctcaatgagcactttagcaaccacactgcaggaagtgttgctgacagtgcagaaggactgccagtgtgaacgtctcttccatggcaattacagcagagccactgagatttgtgtgggggatccaaagaagacacagaccggtttcaagggggactccggggggcccctcgtgtgtaaggacgtagcccaaggtattctctcctatggaaacaaaaaagggacacctccaggagtctacatcaaggtctcacacttcctgccctggataaagagaacaatgaagcgcctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Spi-C transcription factor (Spi-1/PU.1 related)
- T-cell activation RhoGTPase activating protein
- capping protein (actin filament), gelsolin-like
- glutamate-ammonia ligase (glutamine synthetase)

Buy GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene now

Add to cart