GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene View larger

GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014603
Product type: DNA & cDNA
Ncbi symbol: GLIPR1L1
Origin species: Human
Product name: GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene
Size: 2ug
Accessions: BC014603
Gene id: 256710
Gene description: GLI pathogenesis-related 1 like 1
Synonyms: ALKN2972; PRO7434; GLIPR1-like protein 1; GLI pathogenesis related 1 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctgaagaataaattcagttgtttatggatcttgggtctgtgtttggtagccactacatcttccaaaatcccatccatcactgacccacactttatagacaactgcatagaagcccacaacgaatggcgtggcaaagtcaaccctcccgcggccgacatgaaatacatgatttgggataaaggtttagcaaagatggctaaagcatgggcaaaccagtgcaaatttgaacataatgactgtttggataaatcatataaatgctatgcagcttttgaatatgttggagaaaatatctggttaggtggaataaagtcattcacaccaagacatgccattacggcttggtataatgaaacccaattttatgattttgatagtctatcatgctccagagtctgtggccattatacacagttagtttgggccaattcattttatgtcggttgtgcagttgcaatgtgtcctaaccttgggggagcttcaactgcaatatttgtatgcaactacggacctgcaggaaattttgcaaatatgcctccttacgtaagaggagaatcttgctctctctgctcaaaagaagagaaatgtgtaaagaacctctgcaaaaatccatttctgaagccaacggggagagcacctcagcagacagcctttaatccattcagcttaggttttcttcttctgagaatcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 29
- chromosome 4 open reading frame 18
- chromosome 7 open reading frame 62
- chromosome 1 open reading frame 43

Buy GLIPR1L1-GLI pathogenesis-related 1 like 1 Gene now

Add to cart