Login to display prices
Login to display prices
C7orf29-chromosome 7 open reading frame 29 Gene View larger

C7orf29-chromosome 7 open reading frame 29 Gene

PTXBC011406

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf29-chromosome 7 open reading frame 29 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf29-chromosome 7 open reading frame 29 Gene

Proteogenix catalog: PTXBC011406
Ncbi symbol: C7orf29
Product name: C7orf29-chromosome 7 open reading frame 29 Gene
Size: 2ug
Accessions: BC011406
Gene id: 113763
Gene description: chromosome 7 open reading frame 29
Synonyms: C7orf29; ZBED6 C-terminal-like protein; ZBED6 C-terminal like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtccgcgaggcgagtgcggcacaggcctctctgagccaggtgctgccccagctgcgctacctgcacatcttcctggagcaggttcacacacactttcaggagcagagtgtcggggagaggggcgcagccatccagctggctgaggggttggcccggcagctctgcaccgactgtcagctcaacaagctcttctaccgcgaggagtttgtgctggccaccttgctggacccttgcttcaaggggaagattgaggccatcctgccatgggggccgaccgacattgaccactggaagcaagtcctcgtgtacaaggtgaaggagattagagtgtctgaatactctttgaactccccaagtcccctgcaaagccccaggggtctgtgcgtggaccccaccagggtagccaagagctccggggtggaggggagaagccagggggagcctctgcagagcagcagccactctggggccttcctgctggcccagagggagaagggcttgctggagagcatggggctgctggcctctgagagaagcgggggctcgctgtccaccaagagccactgggccagcatcattgtcaagaagtatctgtgggagaatgagaccgttggagcccaggatgaccccctggcttactgggagaagaagcgagaagcctggccaccatctatctgtcttaccccccacaggagccttctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: