C4orf18-chromosome 4 open reading frame 18 Gene View larger

C4orf18-chromosome 4 open reading frame 18 Gene

PTXBC017701

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4orf18-chromosome 4 open reading frame 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C4orf18-chromosome 4 open reading frame 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017701
Product type: DNA & cDNA
Ncbi symbol: C4orf18
Origin species: Human
Product name: C4orf18-chromosome 4 open reading frame 18 Gene
Size: 2ug
Accessions: BC017701
Gene id: 51313
Gene description: chromosome 4 open reading frame 18
Synonyms: C4orf18; AD021; AD036; protein FAM198B; expressed in nerve and epithelium during development; family with sequence similarity 198 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaggtgtttgccttccacctagacaggatcctggggctcaacaggaccctgccgtctgtgagcaggaaagcagagttcatccaagatggccgcccatgccccatcattctttgggatgcatctttatcttcagcaagtaatgacacccattcttctgttaagctcacctggggaacttatcagcagttgctgaaacagaaatgctggcagaatggccgagtacccaagcctgaatcgggttgtactgaaatacatcatcatgagtggtccaagatggcactctttgattttttgttacagatttataatcgcttagatacaaattgctgtggattcagacctcgcaaggaagatgcctgtgtacagaatggattgaggccaaaatgtgatgaccaaggttctgcggctctagcacacattatccagcgaaagcatgacccaaggcatttggtttttatagacaacaagggtttctttgacaggagtgaagataacttaaacttcaaattgttagaaggcatcaaagagtttccagcttctgcagtttctgttttgaagagccagcacttacggcagaaacttcttcagtctctgtttcttgataaagtgtattgggaaagtcaaggaggtagacaaggaattgaaaagcttatcgatgtaatagaacacagagccaaaattcttatcacctatatcaatgcacacggggtcaaagtattacctatgaatgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 62
- chromosome 1 open reading frame 43
- mitochondrial ribosomal protein L28
- chromosome 9 open reading frame 24

Buy C4orf18-chromosome 4 open reading frame 18 Gene now

Add to cart