C9orf24-chromosome 9 open reading frame 24 Gene View larger

C9orf24-chromosome 9 open reading frame 24 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf24-chromosome 9 open reading frame 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf24-chromosome 9 open reading frame 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029484
Product type: DNA & cDNA
Ncbi symbol: C9orf24
Origin species: Human
Product name: C9orf24-chromosome 9 open reading frame 24 Gene
Size: 2ug
Accessions: BC029484
Gene id: 84688
Gene description: chromosome 9 open reading frame 24
Synonyms: CBE1; NYD-SP22; SMRP1; bA573M23.4; spermatid-specific manchette-related protein 1; ciliated bronchial epithelial protein 1; testis development protein NYD-SP22; chromosome 9 open reading frame 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcctgttctcccgtaagaccaggacccctatcagtacctacagtgactcctacagggctcccacctccatcaaggaggtctataaggacccacccctgtgtgcctgggaagccaacaagtttctgactccgggtctgactcataccatggagcgacatgtggatcccgaagccctgcagaagatggccaaatgtgctgtacaggactacacttatagggggtccatatcaggccacccctacttgcctgagaagtactggctttctcaagaggaagcagacaaatgcagcccaaactacctgggcagtgactggtacaacacatggaggatggaaccttacaacagcagctgctgcaacaagtataccacctaccttcctcggctgcctaaggaggccaggatggagacagcagttcgaggaatgcccttggaatgccctcctaggccggagcggctcaatgcctacgagcgcgaagtgatggtgaacatgctgaactcactgtcgcggaaccagcagctgccgcggatcacgccccgatgcgggtgcgtggacccgctgcccggccgcctgcccttccatggttacgaaagtgcttgctcgggccgccactactgtctgcgcgggatggactactacgccagcggggcgccctgcaccgaccgccgcctgcggccttggtgccgggagcaacagactatgtgtacctccctacgagcaccggcccggaatgcagtgtgctgttacaactcccccgccgtcatactacccatatccgaaccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gap junction protein, beta 4, 30.3kDa
- chromosome 2 open reading frame 69
- endoplasmic reticulum protein 27 kDa
- 5'-nucleotidase, cytosolic III-like

Buy C9orf24-chromosome 9 open reading frame 24 Gene now

Add to cart