C1orf43-chromosome 1 open reading frame 43 Gene View larger

C1orf43-chromosome 1 open reading frame 43 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf43-chromosome 1 open reading frame 43 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf43-chromosome 1 open reading frame 43 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000152
Product type: DNA & cDNA
Ncbi symbol: C1orf43
Origin species: Human
Product name: C1orf43-chromosome 1 open reading frame 43 Gene
Size: 2ug
Accessions: BC000152
Gene id: 25912
Gene description: chromosome 1 open reading frame 43
Synonyms: uncharacterized protein C1orf43; HSPC012; NICE-3; NS5ATP4; S863-3; HCV NS5A-transactivated protein 4; hepatitis C virus NS5A-transactivated protein 4; chromosome 1 open reading frame 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccggcagtaactggctctccggggtgaatgtcgtgctggtgatggcctacgggagcctggtgtttgtactgctatttatttttgtgaagaggcaaatcatgcgctttgcaatgaaatctcgaaggggacctcatgtccctgtgggacacaatgcccccaaggacttgaaagaggagattgatattcgactctccagggttcaggatatcaagtatgagccccagctccttgcagatgatgatgctagactactacaactggaaacccagggaaatcaaagttgctacaactatctgtataggatgaaagctctggatgccattcgtacctctgagatcccatttcattctgaaggccggcatccccgttccttaatgggcaagaatttccgctcctacctgctggatctgcgaaacactagtacgcctttcaagggtgtacgcaaagcactcattgatacccttttggatggctatgaaacagcccgctatgggacaggggtctttggccagaatgagtacctacgctatcaggaggccctgagtgagctggccactgcggttaaagcacgaattgggagctctcagcgacatcaccagtcagcagccaaagacctaactcagtcccctgaggtctccccaacaaccatccaggtgacatacctcccctccagtcagaagagtaaacgtgccaagcacttccttgaattgaagagctttaaggataactataacacattggagagtactctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L28
- chromosome 9 open reading frame 24
- gap junction protein, beta 4, 30.3kDa
- chromosome 2 open reading frame 69

Buy C1orf43-chromosome 1 open reading frame 43 Gene now

Add to cart