Login to display prices
Login to display prices
C1orf43-chromosome 1 open reading frame 43 Gene View larger

C1orf43-chromosome 1 open reading frame 43 Gene

PTXBC000152

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf43-chromosome 1 open reading frame 43 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf43-chromosome 1 open reading frame 43 Gene

Proteogenix catalog: PTXBC000152
Ncbi symbol: C1orf43
Product name: C1orf43-chromosome 1 open reading frame 43 Gene
Size: 2ug
Accessions: BC000152
Gene id: 25912
Gene description: chromosome 1 open reading frame 43
Synonyms: uncharacterized protein C1orf43; HSPC012; NICE-3; NS5ATP4; S863-3; HCV NS5A-transactivated protein 4; hepatitis C virus NS5A-transactivated protein 4; chromosome 1 open reading frame 43
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccggcagtaactggctctccggggtgaatgtcgtgctggtgatggcctacgggagcctggtgtttgtactgctatttatttttgtgaagaggcaaatcatgcgctttgcaatgaaatctcgaaggggacctcatgtccctgtgggacacaatgcccccaaggacttgaaagaggagattgatattcgactctccagggttcaggatatcaagtatgagccccagctccttgcagatgatgatgctagactactacaactggaaacccagggaaatcaaagttgctacaactatctgtataggatgaaagctctggatgccattcgtacctctgagatcccatttcattctgaaggccggcatccccgttccttaatgggcaagaatttccgctcctacctgctggatctgcgaaacactagtacgcctttcaagggtgtacgcaaagcactcattgatacccttttggatggctatgaaacagcccgctatgggacaggggtctttggccagaatgagtacctacgctatcaggaggccctgagtgagctggccactgcggttaaagcacgaattgggagctctcagcgacatcaccagtcagcagccaaagacctaactcagtcccctgaggtctccccaacaaccatccaggtgacatacctcccctccagtcagaagagtaaacgtgccaagcacttccttgaattgaagagctttaaggataactataacacattggagagtactctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: