C7orf62-chromosome 7 open reading frame 62 Gene View larger

C7orf62-chromosome 7 open reading frame 62 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf62-chromosome 7 open reading frame 62 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf62-chromosome 7 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028365
Product type: DNA & cDNA
Ncbi symbol: C7orf62
Origin species: Human
Product name: C7orf62-chromosome 7 open reading frame 62 Gene
Size: 2ug
Accessions: BC028365
Gene id: 219557
Gene description: chromosome 7 open reading frame 62
Synonyms: uncharacterized protein C7orf62; chromosome 7 open reading frame 62
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccttttcggtccataaccagaagggcagcaaaaggcctttgccactggaacctcttctttttctccaagtcccacgtagcaattacctgcactttcaagaagagaaacaacgactacacctaaagaaattccttcttgataggatgtttctagtggccaagatacaagcaaatgtagaaagaaaagatgttgctgactactatgaacaaatgtttcagtcagttttgaaacatcacctaggagaagcagtgacaggattgctgctcatctatcccacttccattctgcatatcctcgagtcctccagcgacactctctacaaagttcttttagattatattggccatgtcaaagatgaaacagtattttttattcaacaaatgaaaattatagtcatttctcataacattccaatgaggctttttatgcaatggcatgtttcagtgataaaagttccagttatgtatctcgacgatgtgacacagtcacagtccctaaaggaggtcatcacagattttctcacacaaactcataaactgtcactctacctttgccagactatgaaagtaggcactaaaggaccaggcgataacttacaccaagttgcacctgacctactcctcccagaacaaatcataaagtacttgtgcaaatccgaagaattcatggacccggcaacatttataaacatgtataatagacccatacacatcactctggattctgaggtggtatggcctgctccttcacgtttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 43
- mitochondrial ribosomal protein L28
- chromosome 9 open reading frame 24
- gap junction protein, beta 4, 30.3kDa

Buy C7orf62-chromosome 7 open reading frame 62 Gene now

Add to cart