C2orf49-chromosome 2 open reading frame 49 Gene View larger

C2orf49-chromosome 2 open reading frame 49 Gene

PTXBC001310

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf49-chromosome 2 open reading frame 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf49-chromosome 2 open reading frame 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001310
Product type: DNA & cDNA
Ncbi symbol: C2orf49
Origin species: Human
Product name: C2orf49-chromosome 2 open reading frame 49 Gene
Size: 2ug
Accessions: BC001310
Gene id: 79074
Gene description: chromosome 2 open reading frame 49
Synonyms: asw; ashwin; chromosome 2 open reading frame 49
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggggatgtgggcggtcgcagctgcacggactcggaactgctgctgcacccggagctgctgtcccaggagttccttctcctcactctggagcagaagaacatagctgttgaaactgatgtaagagtaaacaaagacagtcttactgacctttatgtccaacatgcaataccattgcctcagagggatttgccgaagaatagatgggggaaaatgatggaaaagaaaagagaacaacatgagattaaaaatgagactaaaaggagtagcactgtagatgggttaaggaaaagacccctcatcgtatttgatggaagttcaacaagtacaagcataaaagtgaaaaagacagagaatggagataatgatcgactgaagcctcccccgcaggcaagctttaccagtaatgcctttagaaaattatcaaattcctcttcgagtgtttcacccctaattttgtcttccaatttgcctgtgaacaataaaacggaacacaataataatgacgctaaacagaaccatgacttaacgcataggaaaagtccttcaggccctgtgaagtcgccaccattgtcccctgttggaactactccagtgaagttaaagagagctgctcctaaagaagaggcagaggccatgaataacctgaagcccccacaagcaaaaaggaagatacaacatgttacttggccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GLI pathogenesis-related 1 like 1
- chromosome 7 open reading frame 29
- chromosome 4 open reading frame 18
- chromosome 7 open reading frame 62

Buy C2orf49-chromosome 2 open reading frame 49 Gene now

Add to cart