Login to display prices
Login to display prices
C2orf49-chromosome 2 open reading frame 49 Gene View larger

C2orf49-chromosome 2 open reading frame 49 Gene

PTXBC001310

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf49-chromosome 2 open reading frame 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf49-chromosome 2 open reading frame 49 Gene

Proteogenix catalog: PTXBC001310
Ncbi symbol: C2orf49
Product name: C2orf49-chromosome 2 open reading frame 49 Gene
Size: 2ug
Accessions: BC001310
Gene id: 79074
Gene description: chromosome 2 open reading frame 49
Synonyms: asw; ashwin; chromosome 2 open reading frame 49
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggggatgtgggcggtcgcagctgcacggactcggaactgctgctgcacccggagctgctgtcccaggagttccttctcctcactctggagcagaagaacatagctgttgaaactgatgtaagagtaaacaaagacagtcttactgacctttatgtccaacatgcaataccattgcctcagagggatttgccgaagaatagatgggggaaaatgatggaaaagaaaagagaacaacatgagattaaaaatgagactaaaaggagtagcactgtagatgggttaaggaaaagacccctcatcgtatttgatggaagttcaacaagtacaagcataaaagtgaaaaagacagagaatggagataatgatcgactgaagcctcccccgcaggcaagctttaccagtaatgcctttagaaaattatcaaattcctcttcgagtgtttcacccctaattttgtcttccaatttgcctgtgaacaataaaacggaacacaataataatgacgctaaacagaaccatgacttaacgcataggaaaagtccttcaggccctgtgaagtcgccaccattgtcccctgttggaactactccagtgaagttaaagagagctgctcctaaagaagaggcagaggccatgaataacctgaagcccccacaagcaaaaaggaagatacaacatgttacttggccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: