RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene View larger

RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000983
Product type: DNA & cDNA
Ncbi symbol: RBCK1
Origin species: Human
Product name: RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene
Size: 2ug
Accessions: BC000983
Gene id: 10616
Gene description: RanBP-type and C3HC4-type zinc finger containing 1
Synonyms: C20orf18; HOIL-1; HOIL1; PBMEI; PGBM1; RBCK2; RNF54; UBCE7IP3; XAP3; XAP4; ZRANB4; ranBP-type and C3HC4-type zinc finger-containing protein 1; HBV-associated factor 4; RBCC protein interacting with PKC1; RING finger protein 54; heme-oxidized IRP2 ubiquitin ligase 1; hepatitis B virus X-associated protein 4; ubiquitin conjugating enzyme 7 interacting protein 3; RANBP2-type and C3HC4-type zinc finger containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcacagccacgccagatggacgagaagaccaagaaaggctgtgggtgagcgtggaggatgctcagatgcacaccgtcaccatctggctcacagtgcgccctgatatgacagtggcgtctctcaaggacatggtttttctggactatggcttcccaccagtcttgcagcagtgggtgattgggcagcggctggcacgagaccaggagaccctgcactcccatggggtgcggcagaatggggacagtgcctacctctatctgctgtcagcccgcaacacctccctcaaccctcaggagctgcagcgggagcggcagctgcggatgctggaagatctgggcttcaaggacctcacgctgcagccgcggggccctctggagccaggccccccaaagcccggggtcccccaggaacccggacgggggcagccagatgcagtgcctgagcccccaccggtgggctggcagtgccccgggtgcaccttcatcaacaagcccacgcggcctggctgtgagatgtgctgccgggcgcgccccgaggcctaccaggtccccgcctcataccagcccgacgaggaggagcgagcgcgcctggcgggcgaggaggaggcgctgcgtcagtaccagcagggagtgcctgcagggcaccatccgcaacagccaggaggcggaggtctcctgccccttcattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP-binding cassette, sub-family D (ALD), member 3
- ORAI calcium release-activated calcium modulator 1
- mitochondrial translational release factor 1-like
- GTP binding protein overexpressed in skeletal muscle

Buy RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene now

Add to cart