Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of EBI3-Epstein-Barr virus induced 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EBI3-Epstein-Barr virus induced 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015364 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EBI3 |
| Origin species: | Human |
| Product name: | EBI3-Epstein-Barr virus induced 3 Gene |
| Size: | 2ug |
| Accessions: | BC015364 |
| Gene id: | 10148 |
| Gene description: | Epstein-Barr virus induced 3 |
| Synonyms: | IL-27B; IL27B; IL35B; interleukin-27 subunit beta; EBV-induced gene 3 protein; Epstein-Barr virus induced gene 3; IL-27 subunit beta; IL27 subunit; IL35 subunit; cytokine receptor; epstein-Barr virus-induced gene 3 protein; Epstein-Barr virus induced 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccccgcagcttctcctggcccttgtcctctgggccagctgcccgccctgcagtggaaggaaagggcccccagcagctctgacactgccccgggtgcaatgccgagcctctcggtacccgatcgccgtggattgctcctggaccctgccgcctgctccaaactccaccagccccgtgtccttcattgccacgtacaggctcggcatggctgcccggggccacagctggccctgcctgcagcagacgccaacgtccaccagctgcaccatcacggatgtccagctgttctccatggctccctacgtgctcaatgtcaccgccgtccacccctggggctccagcagcagcttcgtgcctttcataacagagcacatcatcaagcccgaccctccagaaggcgtgcgcctaagccccctcgctgagcgccagctacaggtgcagtgggagcctcccgggtcctggcccttcccagagatcttctcactgaagtactggatccgttacaagcgtcagggagctgcgcgcttccaccgggtggggcccattgaagccacgtccttcatcctcagggctgtgcggccccgagccaggtactacgtccaagtggcggctcaggacctcacagactacggggaactgagtgactggagtctccccgccactgccacaatgagcctgggcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - exocyst complex component 7 - transmembrane protein 109 - methyltransferase like 7A - fibroblast growth factor 13 |