EBI3-Epstein-Barr virus induced 3 Gene View larger

EBI3-Epstein-Barr virus induced 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EBI3-Epstein-Barr virus induced 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EBI3-Epstein-Barr virus induced 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015364
Product type: DNA & cDNA
Ncbi symbol: EBI3
Origin species: Human
Product name: EBI3-Epstein-Barr virus induced 3 Gene
Size: 2ug
Accessions: BC015364
Gene id: 10148
Gene description: Epstein-Barr virus induced 3
Synonyms: IL-27B; IL27B; IL35B; interleukin-27 subunit beta; EBV-induced gene 3 protein; Epstein-Barr virus induced gene 3; IL-27 subunit beta; IL27 subunit; IL35 subunit; cytokine receptor; epstein-Barr virus-induced gene 3 protein; Epstein-Barr virus induced 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccccgcagcttctcctggcccttgtcctctgggccagctgcccgccctgcagtggaaggaaagggcccccagcagctctgacactgccccgggtgcaatgccgagcctctcggtacccgatcgccgtggattgctcctggaccctgccgcctgctccaaactccaccagccccgtgtccttcattgccacgtacaggctcggcatggctgcccggggccacagctggccctgcctgcagcagacgccaacgtccaccagctgcaccatcacggatgtccagctgttctccatggctccctacgtgctcaatgtcaccgccgtccacccctggggctccagcagcagcttcgtgcctttcataacagagcacatcatcaagcccgaccctccagaaggcgtgcgcctaagccccctcgctgagcgccagctacaggtgcagtgggagcctcccgggtcctggcccttcccagagatcttctcactgaagtactggatccgttacaagcgtcagggagctgcgcgcttccaccgggtggggcccattgaagccacgtccttcatcctcagggctgtgcggccccgagccaggtactacgtccaagtggcggctcaggacctcacagactacggggaactgagtgactggagtctccccgccactgccacaatgagcctgggcaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - exocyst complex component 7
- transmembrane protein 109
- methyltransferase like 7A
- fibroblast growth factor 13

Buy EBI3-Epstein-Barr virus induced 3 Gene now

Add to cart