Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C16orf79-chromosome 16 open reading frame 79 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C16orf79-chromosome 16 open reading frame 79 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC039154 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C16orf79 |
| Origin species: | Human |
| Product name: | C16orf79-chromosome 16 open reading frame 79 Gene |
| Size: | 2ug |
| Accessions: | BC039154 |
| Gene id: | 283870 |
| Gene description: | chromosome 16 open reading frame 79 |
| Synonyms: | BRICHOS domain-containing protein C16orf79; C16orf79; BRICHOS domain-containing protein 5; BRICHOS domain containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaccagcaagctgctgtgctgagcgccccaaacctgggcctacaggggtgaagaccaagccctcctgcgggggctggagagccgtgggcctgctcctgctgctgctgctgctggtgctggccgctgtggggattgtggctggagggcttcttggctctgctcagggccctcccaagccaaggctgcagacgctgcgaatgaccctcccgagcccccacatgccccggcccaaccaaaccatcctggtggacgtggcccggaacgcggcgaccatcacagtgaccccacctcagagcaaccacagctgggcggtgctgttcgacgggcagagcggctgcatctgttaccgccctgaggagcaccaggtctgcttcctccgcctgatggaggacagtgatcgggagaccctgcggctgctggtggatacctccaaggtccaagaggcttgggtccccagccaggacacccaccacacccaggagctgctggcagtgcaggggagcctcgaagtggaccccgcccaggcgggggctttggtgcagcgcctgtgcatgaggacccccatctactgggcccggcgagcagaggggccccggagacagcggctgatttatctctgcatcgacatctgcttcccgagcaacatctgcgtgtcggtctgcttttattacctcccagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 216 - chromosome 6 open reading frame 142 - chromosome 20 open reading frame 74 - chromosome 18 open reading frame 10 |