Login to display prices
Login to display prices
C16orf79-chromosome 16 open reading frame 79 Gene View larger

C16orf79-chromosome 16 open reading frame 79 Gene

PTXBC039154

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf79-chromosome 16 open reading frame 79 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf79-chromosome 16 open reading frame 79 Gene

Proteogenix catalog: PTXBC039154
Ncbi symbol: C16orf79
Product name: C16orf79-chromosome 16 open reading frame 79 Gene
Size: 2ug
Accessions: BC039154
Gene id: 283870
Gene description: chromosome 16 open reading frame 79
Synonyms: BRICHOS domain-containing protein C16orf79; C16orf79; BRICHOS domain-containing protein 5; BRICHOS domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccagcaagctgctgtgctgagcgccccaaacctgggcctacaggggtgaagaccaagccctcctgcgggggctggagagccgtgggcctgctcctgctgctgctgctgctggtgctggccgctgtggggattgtggctggagggcttcttggctctgctcagggccctcccaagccaaggctgcagacgctgcgaatgaccctcccgagcccccacatgccccggcccaaccaaaccatcctggtggacgtggcccggaacgcggcgaccatcacagtgaccccacctcagagcaaccacagctgggcggtgctgttcgacgggcagagcggctgcatctgttaccgccctgaggagcaccaggtctgcttcctccgcctgatggaggacagtgatcgggagaccctgcggctgctggtggatacctccaaggtccaagaggcttgggtccccagccaggacacccaccacacccaggagctgctggcagtgcaggggagcctcgaagtggaccccgcccaggcgggggctttggtgcagcgcctgtgcatgaggacccccatctactgggcccggcgagcagaggggccccggagacagcggctgatttatctctgcatcgacatctgcttcccgagcaacatctgcgtgtcggtctgcttttattacctcccagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: