C16orf79-chromosome 16 open reading frame 79 Gene View larger

C16orf79-chromosome 16 open reading frame 79 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf79-chromosome 16 open reading frame 79 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf79-chromosome 16 open reading frame 79 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039154
Product type: DNA & cDNA
Ncbi symbol: C16orf79
Origin species: Human
Product name: C16orf79-chromosome 16 open reading frame 79 Gene
Size: 2ug
Accessions: BC039154
Gene id: 283870
Gene description: chromosome 16 open reading frame 79
Synonyms: BRICHOS domain-containing protein C16orf79; C16orf79; BRICHOS domain-containing protein 5; BRICHOS domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccagcaagctgctgtgctgagcgccccaaacctgggcctacaggggtgaagaccaagccctcctgcgggggctggagagccgtgggcctgctcctgctgctgctgctgctggtgctggccgctgtggggattgtggctggagggcttcttggctctgctcagggccctcccaagccaaggctgcagacgctgcgaatgaccctcccgagcccccacatgccccggcccaaccaaaccatcctggtggacgtggcccggaacgcggcgaccatcacagtgaccccacctcagagcaaccacagctgggcggtgctgttcgacgggcagagcggctgcatctgttaccgccctgaggagcaccaggtctgcttcctccgcctgatggaggacagtgatcgggagaccctgcggctgctggtggatacctccaaggtccaagaggcttgggtccccagccaggacacccaccacacccaggagctgctggcagtgcaggggagcctcgaagtggaccccgcccaggcgggggctttggtgcagcgcctgtgcatgaggacccccatctactgggcccggcgagcagaggggccccggagacagcggctgatttatctctgcatcgacatctgcttcccgagcaacatctgcgtgtcggtctgcttttattacctcccagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 216
- chromosome 6 open reading frame 142
- chromosome 20 open reading frame 74
- chromosome 18 open reading frame 10

Buy C16orf79-chromosome 16 open reading frame 79 Gene now

Add to cart