C20orf74-chromosome 20 open reading frame 74 Gene View larger

C20orf74-chromosome 20 open reading frame 74 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf74-chromosome 20 open reading frame 74 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf74-chromosome 20 open reading frame 74 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013749
Product type: DNA & cDNA
Ncbi symbol: C20orf74
Origin species: Human
Product name: C20orf74-chromosome 20 open reading frame 74 Gene
Size: 2ug
Accessions: BC013749
Gene id: 57186
Gene description: chromosome 20 open reading frame 74
Synonyms: C20orf74; AS250; bA287B20.1; dJ1049G11; dJ1049G11.4; p220; ral GTPase-activating protein subunit alpha-2; 250 kDa substrate of Akt; Ral GTPase activating protein, alpha subunit 2 (catalytic); RapGAPalpha2; akt substrate AS250; ral GTPase-activating protein alpha subunit 2; Ral GTPase activating protein catalytic alpha subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattcttgggacagaaggaagaattttcatctattgaagaaaaattcaaaattattgagagagctgaaaaatttggactcccgccagtgccgtgagacacacaaaatcgcagtgttttacattgctgaaggtcaagaagacaagtgttcaatcctctctaatgaaagaggaagccaagcatatgaagactttgttgctggacttggatgggaggtggatctctccacccactgtgggttcatgggtggccttcagcgcaatggcagcaccgggcagacggccccttactatgctacctcaactgtggaagtgattttccatgtttccactcgaatgccgtcagactcagatgattccctcaccaaaaagcttcgtcacttggggaatgacgaggtccatatcgtctggtctgaacactccagagactaccgcaggggtattatcccaactgcctttggagatgtttcaatcattatttacccaatgaagaatcacatgttcttcatcgcgataacgaagaaacctgaggttccattttttgggcctctgtttgatggagccatagtgagtgggaagctgctgccaagccttgtatgtgccacgtgcatcaacgccagcagggctgtgaagtgcctcatcccactctaccagagcttctatgaagagcgagctctgtatctcgaagcaaaattcagaaccaccgcgaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 10
- chromosome 19 open reading frame 34
- chromosome 11 open reading frame 68
- family with sequence similarity 124B

Buy C20orf74-chromosome 20 open reading frame 74 Gene now

Add to cart