FAM124B-family with sequence similarity 124B Gene View larger

FAM124B-family with sequence similarity 124B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM124B-family with sequence similarity 124B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM124B-family with sequence similarity 124B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025754
Product type: DNA & cDNA
Ncbi symbol: FAM124B
Origin species: Human
Product name: FAM124B-family with sequence similarity 124B Gene
Size: 2ug
Accessions: BC025754
Gene id: 79843
Gene description: family with sequence similarity 124B
Synonyms: protein FAM124B; family with sequence similarity 124B; family with sequence similarity 124 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgagacacaggggcctctggccatgactgtccatcttcttgccaactctgggcacggctcccttctgcagaggactctggaccagctcctggattgcatttgcccagaggtccggctctttcaggtgtctgaacgggccagtcctgtgaaatactgtgaaaagtcccattccaagcggtcccggtttccagggatgtccgtgttgctcttcctgcacgaaagcccgggagaggataggctatttcgcgtcctggactctctccagcattcgccatggcagtgctaccccacccaggacactcggggaaggctgtgtccctacttttttgccaatcaggagttctacagcctggacagtcagctgcccatctggggggtgaggcaggtgcactgtggctccgagatcctgagggtgacgctgtactgcagttttgataactatgaagacgccatcagactctacgagatgatcctgcagagagaagcgaccttgcaaaagagcaatttttgtttcttcgtgctctatgcctccaagagctttgctctgcagctctccctgaagcagctgcccccgggaatgtcagtggaccccaaagagtcttcggtgctgcagtttaaggttcaagagatcggccagttagtgcctctgctacccaatccatgcatgcctatcagcagcaccaggtggcagactcaggactacgatggcaacaagattctgcttcagagatgggagtcttcctctgttgcccagactcgagtgcggtggtgccatcatagctccctgaggtcttcaccttctgggttcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 49
- chromosome 17 open reading frame 78
- WD repeat and FYVE domain containing 3
- survival of motor neuron 2, centromeric

Buy FAM124B-family with sequence similarity 124B Gene now

Add to cart