Login to display prices
Login to display prices
FAM124B-family with sequence similarity 124B Gene View larger

FAM124B-family with sequence similarity 124B Gene

PTXBC025754

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM124B-family with sequence similarity 124B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM124B-family with sequence similarity 124B Gene

Proteogenix catalog: PTXBC025754
Ncbi symbol: FAM124B
Product name: FAM124B-family with sequence similarity 124B Gene
Size: 2ug
Accessions: BC025754
Gene id: 79843
Gene description: family with sequence similarity 124B
Synonyms: protein FAM124B; family with sequence similarity 124B; family with sequence similarity 124 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgagacacaggggcctctggccatgactgtccatcttcttgccaactctgggcacggctcccttctgcagaggactctggaccagctcctggattgcatttgcccagaggtccggctctttcaggtgtctgaacgggccagtcctgtgaaatactgtgaaaagtcccattccaagcggtcccggtttccagggatgtccgtgttgctcttcctgcacgaaagcccgggagaggataggctatttcgcgtcctggactctctccagcattcgccatggcagtgctaccccacccaggacactcggggaaggctgtgtccctacttttttgccaatcaggagttctacagcctggacagtcagctgcccatctggggggtgaggcaggtgcactgtggctccgagatcctgagggtgacgctgtactgcagttttgataactatgaagacgccatcagactctacgagatgatcctgcagagagaagcgaccttgcaaaagagcaatttttgtttcttcgtgctctatgcctccaagagctttgctctgcagctctccctgaagcagctgcccccgggaatgtcagtggaccccaaagagtcttcggtgctgcagtttaaggttcaagagatcggccagttagtgcctctgctacccaatccatgcatgcctatcagcagcaccaggtggcagactcaggactacgatggcaacaagattctgcttcagagatgggagtcttcctctgttgcccagactcgagtgcggtggtgccatcatagctccctgaggtcttcaccttctgggttcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: