C11orf68-chromosome 11 open reading frame 68 Gene View larger

C11orf68-chromosome 11 open reading frame 68 Gene

PTXBC010512

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf68-chromosome 11 open reading frame 68 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf68-chromosome 11 open reading frame 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010512
Product type: DNA & cDNA
Ncbi symbol: C11orf68
Origin species: Human
Product name: C11orf68-chromosome 11 open reading frame 68 Gene
Size: 2ug
Accessions: BC010512
Gene id: 83638
Gene description: chromosome 11 open reading frame 68
Synonyms: UPF0696 protein C11orf68; BLES03; P5326; basophilic leukemia-expressed protein Bles03; protein p5326; chromosome 11 open reading frame 68
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccaggtgaggagctggaagaggagggctctccaggtggccgtgaggatggcttcaccgccgagcacctggctgcagaggccatggcagctgacatggacccctggctagtgtttgatgcccgcacaacgcctgccactgagctggatgcctggctggccaagtacccaccatcccaagttacccgctatggggaccccggttcacccaactcagagcctgtgggctggattgcagtgtatgggcagggctacagccccaactccggggacgtgcagggcctgcaggcagcctgggaagctctgcagaccagtgggcggcccatcacaccgggtaccctgcgccagctcgccatcacccaccacgtgctctcgggcaagtggcttatgcatctggcaccgggcttcaagctggaccacgcctgggctggcattgcccgggccgtggttgaaggccggcttcaggtggccaaggtgagcccacgtgccaaggagggtgggcgccaggtcatctgtgtttacacggacgacttcacggaccgcttgggtgtactggaggcggattcagccatccgtgcagcgggcattaagtgcctgctcacctacaagcctgatgtctacacctacctgggcatctaccgggccaatcgctggcacctctgccccactctctatgagagccgtttccagcttgggggtagtgcccgtggctcccgagtgcttgaccgtgccaacaacgtggaactgacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 124B
- chromosome 11 open reading frame 49
- chromosome 17 open reading frame 78
- WD repeat and FYVE domain containing 3

Buy C11orf68-chromosome 11 open reading frame 68 Gene now

Add to cart