Login to display prices
Login to display prices
C18orf10-chromosome 18 open reading frame 10 Gene View larger

C18orf10-chromosome 18 open reading frame 10 Gene

PTXBC015178

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf10-chromosome 18 open reading frame 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf10-chromosome 18 open reading frame 10 Gene

Proteogenix catalog: PTXBC015178
Ncbi symbol: C18orf10
Product name: C18orf10-chromosome 18 open reading frame 10 Gene
Size: 2ug
Accessions: BC015178
Gene id: 25941
Gene description: chromosome 18 open reading frame 10
Synonyms: C18orf10; HMFN0601; L17; PGs2; tubulin polyglutamylase complex subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgaagatgtgaagaacttttacctgatgaccaatggcttccacatgacatggagtgtgaagctggatgagcacatcattccactgggaagcatggcaattaacagcatctcaaaactgactcagctcacccagtcttccatgtattcacttcctaatgcacccactctggcagacctggaggacgatacacatgaagccagtgatgatcagccagagaagcctcactttgactctcgcagtgtgatatttgagctggattcatgcaatggcagtgggaaagtttgccttgtctacaaaagtgggaaaccagcattagcagaagacactgagatctggttcctggacagagcgttatactggcattttctcacagacacctttactgcctattaccgcctgctcatcacccacctgggcctgccccagtggcaatatgccttcaccagctatggcattagcccacaggccaagcaatggttcagcatgtataaacctatcacctacaacacaaacctgctcacagaagagaccgactcctttgtgaataagctagatcccagcaaagtgtttaagagcaagaacaagatcgtaatcccaaaaaagaaagggcctgtgcagcctgcaggtggccagaaagggccctcaggaccctccggtccctccacttcctccacttctaaatcctcctctggctctggaaaccccacccggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: