C6orf142-chromosome 6 open reading frame 142 Gene View larger

C6orf142-chromosome 6 open reading frame 142 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf142-chromosome 6 open reading frame 142 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf142-chromosome 6 open reading frame 142 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009010
Product type: DNA & cDNA
Ncbi symbol: C6orf142
Origin species: Human
Product name: C6orf142-chromosome 6 open reading frame 142 Gene
Size: 2ug
Accessions: BC009010
Gene id: 90523
Gene description: chromosome 6 open reading frame 142
Synonyms: C6orf142; CIP; muscular LMNA-interacting protein; cardiac ISL1-interacting protein; muscle-enriched A-type lamin interacting protein; muscular-enriched A-type laminin-interacting protein; muscular LMNA interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgcagctggtaccttggatttgaatgttcttctaaatccaatgactacttgaccttgaatgctgggagccaacaagagagagaccaagcgaaattgacttgtccttcagaggtcagtggaacgattttacaagaaagggaattcgaagcaaacaaacttcaagggatgcagcaaagtgacctcttcaaagctgaatatgtccttattgtggactccgaaggggaagatgaggctgcaagcagaaaagttgaacaaggccccccaggggggattggcaccgcagctatccggcccaagtctctagctatctcgtccagtctggtctctgatgtagtgcgtcccaaaacacaggggactgatctcaagacctcatcacatcctgaaatgcttcatgggatggcccctcagcaaaagcatgggcagactcctacaactcttccaagagcagctggtcgagaaaccaaatatgcaaatctctcctcaccaacttctacagtatctgagagtcagctgactaagcctggagtaattcgcccagtacctgtaaaatccagaatattactgaaaaaagaggaggaagtctatgaacccacccctttcagtaaatacttggaagataacagcgacctcttttctgaacagctgagtcatccaatggtggctattcctgaacatgaagctcttgattccaaagagcaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 74
- chromosome 18 open reading frame 10
- chromosome 19 open reading frame 34
- chromosome 11 open reading frame 68

Buy C6orf142-chromosome 6 open reading frame 142 Gene now

Add to cart