C1orf216-chromosome 1 open reading frame 216 Gene View larger

C1orf216-chromosome 1 open reading frame 216 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf216-chromosome 1 open reading frame 216 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf216-chromosome 1 open reading frame 216 Gene

Proteogenix catalog: PTXBC026909
Ncbi symbol: C1orf216
Product name: C1orf216-chromosome 1 open reading frame 216 Gene
Size: 2ug
Accessions: BC026909
Gene id: 127703
Gene description: chromosome 1 open reading frame 216
Synonyms: UPF0500 protein C1orf216; chromosome 1 open reading frame 216
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcgccatccagccagggctagctgaggggggccaattcctgggggacccacctcctggattatgtcagcccgagctccaaccagacagcaactccaacttcatggcaagtgccaaggatgctaacgagaattggcatgggatgccaggcagagtggaacctatcctgaggaggagctcctctgagtcaccctctgacaaccaagccttccaggcccctggatcccctgaggaaggggtgcgcagccccccagagggggcagagattcccggggctgagcctgagaagatgggtggtgctggcacagtctgctcccctctggaggacaacggctatgccagcagttccctgagcattgacagccgtagcagcagtcctgagcctgcctgtgggaccccgcgaggccctggccctcccgatccccttctgccctcagtggcccaggctgtgcagcacttacaagtccaggagcgctacaaagagcaggagaaggaaaagcaccacgtgcacttggtgatgtaccgtcgcctggcactgctccagtggatccggggcctgcagcatcagttgattgaccagcaggcccgactgcaggagagcttcgacaccatcctagacaaccggaaggagcttattcgctgtctccagcagagggcagcaccatccaggccccaggaccaggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy C1orf216-chromosome 1 open reading frame 216 Gene now

Add to cart