TMEM86B-transmembrane protein 86B Gene View larger

TMEM86B-transmembrane protein 86B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM86B-transmembrane protein 86B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM86B-transmembrane protein 86B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023000
Product type: DNA & cDNA
Ncbi symbol: TMEM86B
Origin species: Human
Product name: TMEM86B-transmembrane protein 86B Gene
Size: 2ug
Accessions: BC023000
Gene id: 255043
Gene description: transmembrane protein 86B
Synonyms: lysoplasmalogenase; alkenylglycerophosphocholine hydrolase; alkenylglycerophosphoethanolamine hydrolase; transmembrane protein 86B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgctggcaaagcggggcagaccctgaagactcactgctcagcccagcgcccagatgtctgcaggtggctgagccccttcatcctctcctgctgcgtgtacttctgcctctggattcccgaggaccagctgtcctggttcgctgccctggtcaagtgcctgcctgtcctctgcctggctgggttcctgtgggtcatgtccccaagcgggggctacacccagctcctccagggagcccttgtgtgctcggctgtgggggacgcttgcctcatctggccggcagccttcgtccctggcatggccgcctttgccaccgcccacctcctctacgtctgggccttcggcttctctcccctgcagcccggcctgctgctgctcatcatcctggcccctggcccctacctcagccttgtgctccagcacctcgagccggatatggtcctgccggtggcagcctatgggctgatcctgatggccatgctgtggcgcggcctggcccagggcgggagtgccggctggggcgcgctgctcttcacgctctctgatggcgtgctggcctgggacaccttcgcccagcccctgccccatgcccgcctggtgatcatgaccacctactatgctgcccagctcctcatcacactgtcagccctcaggagcccggtgcccaagactgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Epstein-Barr virus induced 3
- exocyst complex component 7
- transmembrane protein 109
- methyltransferase like 7A

Buy TMEM86B-transmembrane protein 86B Gene now

Add to cart