GJB2-gap junction protein, beta 2, 26kDa Gene View larger

GJB2-gap junction protein, beta 2, 26kDa Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GJB2-gap junction protein, beta 2, 26kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GJB2-gap junction protein, beta 2, 26kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017048
Product type: DNA & cDNA
Ncbi symbol: GJB2
Origin species: Human
Product name: GJB2-gap junction protein, beta 2, 26kDa Gene
Size: 2ug
Accessions: BC017048
Gene id: 2706
Gene description: gap junction protein, beta 2, 26kDa
Synonyms: CX26; DFNA3; DFNA3A; DFNB1; DFNB1A; HID; KID; NSRD1; PPK; gap junction beta-2 protein; connexin 26; gap junction protein, beta 2, 26kDa; mutant gap junction protein beta 2; gap junction protein beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattggggcacgctgcagacgatcctggggggtgtgaacaaacactccaccagcattggaaagatctggctcaccgtcctcttcatttttcgcattatgatcctcgttgtggctgcaaaggaggtgtggggagatgagcaggccgactttgtctgcaacaccctgcagccaggctgcaagaacgtgtgctacgatcactacttccccatctcccacatccggctatgggccctgcagctgatcttcgtgtccacgccagcgctcctagtggccatgcacgtggcctaccggagacatgagaagaagaggaagttcatcaagggggagataaagagtgaatttaaggacatcgaggagatcaaaacccagaaggtccgcatcgaaggctccctgtggtggacctacacaagcagcatcttcttccgggtcatcttcgaagccgccttcatgtacgtcttctatgtcatgtacgacggcttctccatgcagcggctggtgaagtgcaacgcctggccttgtcccaacactgtggactgctttgtgtcccggcccacggagaagactgtcttcacagtgttcatgattgcagtgtctggaatttgcatcctgctgaatgtcactgaattgtgttatttgctaattagatattgttctgggaagtcaaaaaagccagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 2
- cysteine-rich secretory protein 2
- leucine rich repeat containing 61
- gap junction protein, beta 3, 31kDa

Buy GJB2-gap junction protein, beta 2, 26kDa Gene now

Add to cart