Login to display prices
Login to display prices
PRTFDC1-phosphoribosyl transferase domain containing 1 Gene View larger

PRTFDC1-phosphoribosyl transferase domain containing 1 Gene

PTXBC008662

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRTFDC1-phosphoribosyl transferase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRTFDC1-phosphoribosyl transferase domain containing 1 Gene

Proteogenix catalog: PTXBC008662
Ncbi symbol: PRTFDC1
Product name: PRTFDC1-phosphoribosyl transferase domain containing 1 Gene
Size: 2ug
Accessions: BC008662
Gene id: 56952
Gene description: phosphoribosyl transferase domain containing 1
Synonyms: HHGP; phosphoribosyltransferase domain-containing protein 1; phosphoribosyl transferase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgggagcagcgaggaggcgccagactacgggcgaggcgtcgtgattatggatgattggccagggtatgacttgaatttattcacgtacccacagcactattatggagacttggagtatgtcctcatccctcatggtatcattgtggacagaattgagcggctggccaaggatattatgaaagacataggatatagtgacatcatggtcctgtgtgtgcttaaaggaggttacaaattctgtgctgatctcgtagaacaccttaagaacatcagccgaaattcagatcgatttgtctcaatgaaggttgatttcatcagactaaaaagttacaggaatgaccagtccatgggtgagatgcagataatcggaggcgatgatctttcaacgctggctggaaagaatgttctcattgttgaggatgttgtcggaactgggaggaccatgaaagcactactcagcaatatagagaaatacaagcccaacatgattaaggtagccagtttgttggtgaagagaacatccagaagtgacggctttagacctgactatgctggatttgagattccaaacttatttgtggtgggatatgccttagattacaatgaatacttcagagatctgaatcacatatgcgtcatcaatgagcacggtaaagaaaaatatcgagtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: