Login to display prices
Login to display prices
GINS4-GINS complex subunit 4 (Sld5 homolog) Gene View larger

GINS4-GINS complex subunit 4 (Sld5 homolog) Gene

PTXBC005995

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GINS4-GINS complex subunit 4 (Sld5 homolog) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GINS4-GINS complex subunit 4 (Sld5 homolog) Gene

Proteogenix catalog: PTXBC005995
Ncbi symbol: GINS4
Product name: GINS4-GINS complex subunit 4 (Sld5 homolog) Gene
Size: 2ug
Accessions: BC005995
Gene id: 84296
Gene description: GINS complex subunit 4 (Sld5 homolog)
Synonyms: DNA replication complex GINS protein SLD5; SLD5 homolog; GINS complex subunit 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgaagaagtggatttcctgggacaggactctgatgggggtagtgaggaagtggtcctaactcctgcagagctcattgaaagattggagcaggcctggatgaatgaaaagtttgcccctgagctgctggagagcaagcctgagattgtagaatgtgtcatggaacagctggagcacatggaagaaaatctcaggagagccaaaagggaggacctgaaggtcagcatccaccaaatggagatggagaggatccgctacgtcctcagcagctacttgcggtgtcgcctcatgaagatagagaagtttttccctcatgtccttgagaaggaaaaaacacgtcctgagggggagccttccagcctctcgccggaagagttggcctttgccagagagttcatggcgaacacagagtcctatctgaaaaatgtcgccttgaagcacatgccccctaacttacagaaggtggacctctttcgggcagttcccaaaccagatctagattcttacgtgtttctgagagtgagagaacgacaagaaaacatactggtagaaccagacacagatgagcagagggactacgtgattgacctggagaagggctcacagcacttgatccgatacaaaaccattgcacctctggttgcatctggagctgtccagctaatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: