Login to display prices
Login to display prices
SCAMP3-secretory carrier membrane protein 3 Gene View larger

SCAMP3-secretory carrier membrane protein 3 Gene

PTXBC010505

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP3-secretory carrier membrane protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP3-secretory carrier membrane protein 3 Gene

Proteogenix catalog: PTXBC010505
Ncbi symbol: SCAMP3
Product name: SCAMP3-secretory carrier membrane protein 3 Gene
Size: 2ug
Accessions: BC010505
Gene id: 10067
Gene description: secretory carrier membrane protein 3
Synonyms: C1orf3; secretory carrier-associated membrane protein 3; propin 1; secretory carrier membrane protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcagagcagagacggcggaaacccgttcgccgagcccagcgagcttgacaacccctttcagccaccaccagcctatgagcctccagcccctgccccattgcctccaccctcagctccctccttgcagccctcgagaaagctcagccccacagaacctaagaactatggctcatacagcactcaggcctcagctgcagcagccacagctgagctgctgaagaaacaggaggagctcaaccggaaggcagaggagttggaccgaagggagcgagagctgcagcatgctgccctggggggcacagctactcgacagaacaattggccccctctaccttctttttgtccagttcagccctgctttttccaggacatctccatggagatcccccaagaatttcagaagactgtatccaccatgtactacctctggatgtgcagcacgctggctcttctcctgaacttcctcgcctgcctggccagcttctgtgtggaaaccaacaatggcgcaggctttgggctttctatcctctgggtcctccttttcactccctgctcctttgtctgctggtaccgccccatgtataaggctttccggagtgacagttcattcaatttcttcgttttcttcttcattttcttcgtccaggatgtgctctttgtcctccaggccattggtatcccaggttggggattcagtggctggatctctgctctggtggtgccgaagggcaacacagcagtatccgtgctcatgctgctggtcgccctgctcttcactggcattgctgtgctaggaattgtcatgctgaaacggatccactccttataccgccgcacaggtgccagctttcagaaggcccagcaagaatttgctgctggtgtcttctccaaccctgcggtgcgaaccgcagctgccaatgcagccgctggggctgctgaaaatgccttccgggccccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: