MFGE8-milk fat globule-EGF factor 8 protein Gene View larger

MFGE8-milk fat globule-EGF factor 8 protein Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MFGE8-milk fat globule-EGF factor 8 protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MFGE8-milk fat globule-EGF factor 8 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003610
Product type: DNA & cDNA
Ncbi symbol: MFGE8
Origin species: Human
Product name: MFGE8-milk fat globule-EGF factor 8 protein Gene
Size: 2ug
Accessions: BC003610
Gene id: 4240
Gene description: milk fat globule-EGF factor 8 protein
Synonyms: BA46; EDIL1; HMFG; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10; hP47; lactadherin; O-acetyl disialoganglioside synthase; breast epithelial antigen BA46; medin; sperm associated antigen 10; sperm surface protein hP47; milk fat globule-EGF factor 8 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgcccccgcctgctggccgcgctgtgcggcgcgctgctctgcgcccccagcctcctcgtcgccctggatatctgttccaaaaacccctgccacaacggtggtttatgcgaggagatttcccaagaagtgcgaggagatgtcttcccctcgtacacctgcacgtgccttaagggctacgcgggcaaccactgtgagacgaaatgtgtcgagccactgggcatggagaatgggaacattgccaactcacagatcgccgcctcatctgtgcgtgtgaccttcttgggtttgcagcattgggtcccggagctggcccgcctgaaccgcgcaggcatggtcaatgcctggacacccagcagcaatgacgataacccctggatccaggtgaacctgctgcggaggatgtgggtaacaggtgtggtgacgcagggtgccagccgcttggccagtcatgagtacctgaaggccttcaaggtggcctacagccttaatggacacgaattcgatttcatccatgatgttaataaaaaacacaaggagtttgtgggtaactggaacaaaaacgcggtgcatgtcaacctgtttgagacccctgtggaggctcagtacgtgagattgtaccccacgagctgccacacggcctgcactctgcgctttgagctactgggctgtgagctgaacggatgcgccaatcccctgggcctgaagaataacagcatccctgacaagcagatcacggcctccagcagctacaagacctggggcttgcatctcttcagctggaacccctcctatgcacggctggacaagcagggcaacttcaacgcctgggttgcggggagctacggtaacgatcagtggctgcagatcttccctggcaactgggacaaccactcccacaagaagaacttgtttgagacgcccatcctggctcgctatgtgcgcatcctgcctgtagcctggcacaaccgcatcgccctgcgcctggagctgctgggctgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - butyrophilin, subfamily 2, member A2
- secretory carrier membrane protein 1
- secretory carrier membrane protein 3
- rhabdoid tumor deletion region gene 1

Buy MFGE8-milk fat globule-EGF factor 8 protein Gene now

Add to cart