Login to display prices
Login to display prices
SCAMP5-secretory carrier membrane protein 5 Gene View larger

SCAMP5-secretory carrier membrane protein 5 Gene

PTXBC024700

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP5-secretory carrier membrane protein 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP5-secretory carrier membrane protein 5 Gene

Proteogenix catalog: PTXBC024700
Ncbi symbol: SCAMP5
Product name: SCAMP5-secretory carrier membrane protein 5 Gene
Size: 2ug
Accessions: BC024700
Gene id: 192683
Gene description: secretory carrier membrane protein 5
Synonyms: secretory carrier-associated membrane protein 5; hSCAMP5; secretory carrier membrane protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagaaagtgaacaacttcccaccattgcccaaattcatcccgctgaagccatgtttctaccaagacttcgaggcagatattcctccccagcatgtcagcatgaccaagcgcctctactacctctggatgttgaacagcgtcacgctggccgtgaacctggtgggctgtctcgcgtggctgatcggaggcgggggagccaccaactttggcctcgcctttctctggctcatcctcttcacaccctgctcctacgtctgctggtttcggcccatttacaaggccttcaagactgacagctccttcagtttcatggcattcttctttaccttcatggctcagttggtcatcagcatcatccaggccgtgggcatcccaggctggggcgtctgcggctggattgctaccatctccttcttcggaacgaacattggctcggcggtggtgatgctaattcccactgtcatgttcacagtgatggccgtcttttccttcatcgccctcagcatggttcataaattttaccggggaagtggggggagtttcagcaaagctcaggaggagtggaccacaggggcctggaagaatccacatgtgcagcaggcagcccagaacgcagccatgggggcagcccagggtgccatgaatcagcctcagactcagtattccgccacccccaattacacgtactccaatgagatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: