SCAMP4-secretory carrier membrane protein 4 Gene View larger

SCAMP4-secretory carrier membrane protein 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP4-secretory carrier membrane protein 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP4-secretory carrier membrane protein 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011747
Product type: DNA & cDNA
Ncbi symbol: SCAMP4
Origin species: Human
Product name: SCAMP4-secretory carrier membrane protein 4 Gene
Size: 2ug
Accessions: BC011747
Gene id: 113178
Gene description: secretory carrier membrane protein 4
Synonyms: SCAMP-4; secretory carrier-associated membrane protein 4; secretory carrier membrane protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaaaaggagaacaacttcccgccactgcccaagttcatccctgtgaagccctgcttctaccagaacttctccgacgagatcccagtggagcaccaggtcctggtgaagaggatctaccggctgtggatgttttactgcgccaccctcggcgtcaacctcattgcctgcctggcctggtggatcggcggaggctcggggaccaacttcggcctggccttcgtgtggctgctcctgttcacgccttgcggctacgtgtgctggttccggcctgtctacaaggccttccgagccgacagctcctttaatttcatggcgtttttcttcatcttcggagcccagtttgtcctgaccgtcatccaggcgattggcttctccggctggggcgcgtgcggctggctgtcggcaattggattcttccagtacagcccgggcgctgccgtggtcatgctgcttccagccatcatgttctccgtgtcggctgccatgatggccatcgcgatcatgaaggtgcacaggatctaccgaggggctggcggaagcttccagaaggcacagacggagtggaacacgggcacttggcggaacccaccgtcgagggaggcccagtacaacaacttctcaggcaacagcctgcccgagtaccccactgtgcccagctacccgggcagtggccagtggccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secretory carrier membrane protein 5
- secretory carrier membrane protein 3
- milk fat globule-EGF factor 8 protein
- butyrophilin, subfamily 2, member A2

Buy SCAMP4-secretory carrier membrane protein 4 Gene now

Add to cart