Login to display prices
Login to display prices
SCAMP4-secretory carrier membrane protein 4 Gene View larger

SCAMP4-secretory carrier membrane protein 4 Gene

PTXBC011747

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP4-secretory carrier membrane protein 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP4-secretory carrier membrane protein 4 Gene

Proteogenix catalog: PTXBC011747
Ncbi symbol: SCAMP4
Product name: SCAMP4-secretory carrier membrane protein 4 Gene
Size: 2ug
Accessions: BC011747
Gene id: 113178
Gene description: secretory carrier membrane protein 4
Synonyms: SCAMP-4; secretory carrier-associated membrane protein 4; secretory carrier membrane protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaaaaggagaacaacttcccgccactgcccaagttcatccctgtgaagccctgcttctaccagaacttctccgacgagatcccagtggagcaccaggtcctggtgaagaggatctaccggctgtggatgttttactgcgccaccctcggcgtcaacctcattgcctgcctggcctggtggatcggcggaggctcggggaccaacttcggcctggccttcgtgtggctgctcctgttcacgccttgcggctacgtgtgctggttccggcctgtctacaaggccttccgagccgacagctcctttaatttcatggcgtttttcttcatcttcggagcccagtttgtcctgaccgtcatccaggcgattggcttctccggctggggcgcgtgcggctggctgtcggcaattggattcttccagtacagcccgggcgctgccgtggtcatgctgcttccagccatcatgttctccgtgtcggctgccatgatggccatcgcgatcatgaaggtgcacaggatctaccgaggggctggcggaagcttccagaaggcacagacggagtggaacacgggcacttggcggaacccaccgtcgagggaggcccagtacaacaacttctcaggcaacagcctgcccgagtaccccactgtgcccagctacccgggcagtggccagtggccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: