DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene View larger

DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene

PTXBC028912

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028912
Product type: DNA & cDNA
Ncbi symbol: DNAJB9
Origin species: Human
Product name: DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene
Size: 2ug
Accessions: BC028912
Gene id: 4189
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 9
Synonyms: ERdj4; MDG-1; MDG1; MST049; MSTP049; dnaJ homolog subfamily B member 9; DnaJ (Hsp40) homolog, subfamily B, member 9; ER-resident protein ERdj4; endoplasmic reticulum DNA J domain-containing protein 4; endoplasmic reticulum DnaJ homolog 4; microvascular endothelial differentiation gene 1 protein; DnaJ heat shock protein family (Hsp40) member B9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctactccccagtcaattttcatctttgcaatctgcattttaatgataacagaattaattctggcctcaaaaagctactatgatatcttaggtgtgccaaaatcggcatcagagcgccaaatcaagaaggcctttcacaagttggccatgaagtaccaccctgacaaaaataagagcccggatgctgaagcaaaattcagagagattgcagaagcatatgaaacactctcagatgctaatagacgaaaagagtatgatacacttggacacagtgcttttactagtggtaaaggacaaagaggtagtggaagttcttttgagcagtcatttaacttcaattttgatgacttatttaaagactttggcttttttggtcaaaaccaaaacactggatccaagaagcgttttgaaaatcatttccagacacgccaggatggtggttccagtagacaaaggcatcatttccaagaattttcttttggaggtggattatttgatgacatgtttgaagatatggagaaaatgttttcttttagtggttttgactctaccaatcagcatacagtacagactgaaaatagatttcatggatctagcaagcactgcaggactgtcactcaacgaagaggaaatatggttactacatacactgactgttcaggacagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alkB, alkylation repair homolog 8 (E. coli)
- phosphatidylinositol transfer protein, beta
- hydroxysteroid (17-beta) dehydrogenase 11
- DnaJ (Hsp40) homolog, subfamily B, member 2

Buy DNAJB9-DnaJ (Hsp40) homolog, subfamily B, member 9 Gene now

Add to cart