HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene View larger

HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene

PTXBC014327

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014327
Product type: DNA & cDNA
Ncbi symbol: HSD17B11
Origin species: Human
Product name: HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene
Size: 2ug
Accessions: BC014327
Gene id: 51170
Gene description: hydroxysteroid (17-beta) dehydrogenase 11
Synonyms: 17-BETA-HSD11; 17-BETA-HSDXI; 17BHSD11; DHRS8; PAN1B; RETSDR2; SDR16C2; estradiol 17-beta-dehydrogenase 11; 17-beta-hydroxysteroid dehydrogenase type XI; CTCL tumor antigen HD-CL-03; CTCL-associated antigen HD-CL-03; cutaneous T-cell lymphoma-associated antigen HD-CL-03; dehydrogenase/reductase SDR family member 8; retinal short-chain dehydrogenase/reductase 2; short chain dehydrogenase/reductase family 16C member 2; hydroxysteroid 17-beta dehydrogenase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatttcttctggacatcctcctgcttctcccgttactgatcgtctgctccctagagtccttcgtgaagctttttattcctaagaggagaaaatcagtcaccggcgaaatcgtgctgattacaggagctgggcatggaattgggagactgactgcctatgaatttgctaaacttaaaagcaagctggttctctgggatataaataagcatggactggaggaaacagctgccaaatgcaagggactgggtgccaaggttcatacctttgtggtagactgcagcaaccgagaagatatttacagctctgcaaagaaggtgaaggcagaaattggagatgttagtattttagtaaataatgctggtgtagtctatacatcagatttgtttgctacacaagatcctcagattgaaaagacttttgaagttaatgtacttgcacatttctggactacaaaggcatttcttcctgcaatgacgaagaataaccatggccatattgtcactgtggcttcggcagctggacatgtctcggtccccttcttactggcttactgttcaagcaagtttgctgctgttggatttcataaaactttgacagatgaactggctgccttacaaataactggagtcaaaacaacatgtctgtgtcctaatttcgtaaacactggcttcatcaaaaatccaagtacaagtttgggacccactctggaacctgaggaagtggtaaacaggctgatgcatgggattctgactgagcagaagatgatttttattccatcttctatagcttttttaacaacattggaaaggatccttcctgagcgtttcctggcagttttaaaacgaaaaatcagtgttaagtttgatgcagttattggatataaaatgaaagcgcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily B, member 2
- major histocompatibility complex, class I, A
- major histocompatibility complex, class I, A
- major histocompatibility complex, class I, C

Buy HSD17B11-hydroxysteroid (17-beta) dehydrogenase 11 Gene now

Add to cart