Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011609 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJB2 |
| Origin species: | Human |
| Product name: | DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC011609 |
| Gene id: | 3300 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily B, member 2 |
| Synonyms: | CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3; dnaJ homolog subfamily B member 2; DnaJ (Hsp40) homolog, subfamily B, member 2; dnaJ protein homolog 1; heat shock 40 kDa protein 3; heat shock protein J1; heat shock protein, neuronal DNAJ-like 1; DnaJ heat shock protein family (Hsp40) member B2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatcctactacgagatcctagacgtgccgcgaagtgcgtccgctgatgacatcaagaaggcgtatcggcgcaaggctctccagtggcacccagacaaaaacccagataataaagagtttgctgagaagaaatttaaggaggtggccgaggcatatgaagtgctgtctgacaagcacaagcgggagatttacgaccgctatggccgggaagggctgacagggacaggaactggcccatctcgggcagaagctggcagtggtgggcctggcttcaccttcaccttccgcagccccgaggaggtcttccgggaattctttgggagtggagacccttttgcagagctctttgatgacctgggccccttctcagagcttcagaaccggggttcccgacactcaggccccttctttaccttctcttcctccttccctgggcactccgatttctcctcctcatctttctccttcagtcctggggctggtgcttttcgctctgtttctacatctaccacctttgtccaaggacgccgcatcaccacacgcagaatcatggagaacgggcaggagcgggtggaagtggaggaggatgggcagctgaagtcagtcacaatcaatggtgtcccagatgacctggcactgggcttggagctgagccgtcgcgagcagcagccgtcagtcacttccaggtctgggggcactcaggtccagcagacccctgcctcatgccccttggacagcgacctctctgaggatgaggacctgcagctggccatggcctacagcctgtcagagatggaggcagctgggaagaaacccgcaggtgggcgggaggcacagcaccgacggcaggggcggcccaaggcccagcaccaagatccaggcttgggggggacccaggagggtgcgaggggtgaagcaaccaaacgcagtccatccccagaggagaaggcctctcgctgcctcatcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class I, A - major histocompatibility complex, class I, A - major histocompatibility complex, class I, C - DnaJ (Hsp40) homolog, subfamily A, member 1 |