Login to display prices
Login to display prices
DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene View larger

DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene

PTXBC011609

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene

Proteogenix catalog: PTXBC011609
Ncbi symbol: DNAJB2
Product name: DNAJB2-DnaJ (Hsp40) homolog, subfamily B, member 2 Gene
Size: 2ug
Accessions: BC011609
Gene id: 3300
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 2
Synonyms: CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3; dnaJ homolog subfamily B member 2; DnaJ (Hsp40) homolog, subfamily B, member 2; dnaJ protein homolog 1; heat shock 40 kDa protein 3; heat shock protein J1; heat shock protein, neuronal DNAJ-like 1; DnaJ heat shock protein family (Hsp40) member B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatcctactacgagatcctagacgtgccgcgaagtgcgtccgctgatgacatcaagaaggcgtatcggcgcaaggctctccagtggcacccagacaaaaacccagataataaagagtttgctgagaagaaatttaaggaggtggccgaggcatatgaagtgctgtctgacaagcacaagcgggagatttacgaccgctatggccgggaagggctgacagggacaggaactggcccatctcgggcagaagctggcagtggtgggcctggcttcaccttcaccttccgcagccccgaggaggtcttccgggaattctttgggagtggagacccttttgcagagctctttgatgacctgggccccttctcagagcttcagaaccggggttcccgacactcaggccccttctttaccttctcttcctccttccctgggcactccgatttctcctcctcatctttctccttcagtcctggggctggtgcttttcgctctgtttctacatctaccacctttgtccaaggacgccgcatcaccacacgcagaatcatggagaacgggcaggagcgggtggaagtggaggaggatgggcagctgaagtcagtcacaatcaatggtgtcccagatgacctggcactgggcttggagctgagccgtcgcgagcagcagccgtcagtcacttccaggtctgggggcactcaggtccagcagacccctgcctcatgccccttggacagcgacctctctgaggatgaggacctgcagctggccatggcctacagcctgtcagagatggaggcagctgggaagaaacccgcaggtgggcgggaggcacagcaccgacggcaggggcggcccaaggcccagcaccaagatccaggcttgggggggacccaggagggtgcgaggggtgaagcaaccaaacgcagtccatccccagaggagaaggcctctcgctgcctcatcctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: