HLA-C-major histocompatibility complex, class I, C Gene View larger

HLA-C-major histocompatibility complex, class I, C Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-C-major histocompatibility complex, class I, C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-C-major histocompatibility complex, class I, C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008457
Product type: DNA & cDNA
Ncbi symbol: HLA-C
Origin species: Human
Product name: HLA-C-major histocompatibility complex, class I, C Gene
Size: 2ug
Accessions: BC008457
Gene id: 3107
Gene description: major histocompatibility complex, class I, C
Synonyms: major histocompatibility antigen HLA-C; MHC class I antigen heavy chain HLA-C; HLA-C antigen; HLA-C alpha chain; D6S204; HLA-JY3; HLAC; HLC-C; MHC; PSORS1; HLA class I histocompatibility antigen, Cw-1 alpha chain; HLA class I histocompatibility antigen, C alpha chain; human leukocyte antigen-C alpha chain; major histocompatibility complex, class I, C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggtcatggcgccccgaaccctcatcctgctgctctcgggagccctggccctgaccgagacctgggccggctcccactccatgaggtatttctacaccgctgtgtcccggcccggccgcggggagccccacttcatcgcagtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagtccgagaggggagccgcgggcgccgtgggtggagcaggaggggccggagtattgggaccgggagacacagaagtacaagcgccaggcacagactgaccgagtgagcctgcggaacctgcgcggctactacaaccagagcgaggccaggtctcacatcatccagaggatgtatggctgcgacgtggggcccgacgggcgcctcctccgcgggtatgaccagtacgcctacgacggcaaggattacatcgccctgaacgaggatctgcgctcctggaccgccgcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgaggcggagcagctgagagcctacctggagggcctgtgcgtggagtggctccgcagatacctgaagaatgggaaggagacgctgcagcgcgcggaacacccaaagacacacgtgacccaccatcccgtctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagtgggatggggaggaccaaactcaggacactgagcttgtggagaccaggccagcaggagatggaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacgtgccatgtgcagcacgaggggctgccggagcccctcaccctgagatgggagccgtcttcccagcccaccatccccatcgtgggcatcgttgctggcctggctgtcctggctgtcctagctgtcctaggagctgtggtggctgttgtgatgtgtaggaggaagagctcagggcattttcttcccacaggtggaaaaggagggagctgctctcaggctgcgtccagcaacagtgcccagggctctgatgagtctctcatcgcttgtaaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily A, member 1
- V-set and immunoglobulin domain containing 4
- DnaJ (Hsp40) homolog, subfamily A, member 2
- interferon-related developmental regulator 2

Buy HLA-C-major histocompatibility complex, class I, C Gene now

Add to cart