DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene View larger

DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008182
Product type: DNA & cDNA
Ncbi symbol: DNAJA1
Origin species: Human
Product name: DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene
Size: 2ug
Accessions: BC008182
Gene id: 3301
Gene description: DnaJ (Hsp40) homolog, subfamily A, member 1
Synonyms: DJ-2; DjA1; HDJ2; HSDJ; HSJ-2; HSJ2; HSPF4; NEDD7; hDJ-2; dnaJ homolog subfamily A member 1; DnaJ (Hsp40) homolog, subfamily A, member 1; dnaJ protein homolog 2; heat shock 40 kDa protein 4; heat shock protein J2; heat shock protein, DNAJ-like 2; human DnaJ protein 2; neural precursor cell expressed, developmentally down-regulated 7; DnaJ heat shock protein family (Hsp40) member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaaagaaacaacttactacgatgttttgggggtcaaacccaatgctactcaggaagaattgaaaaaggcttataggaaactggccttgaagtaccatcctgataagaacccaaatgaaggagagaagtttaaacagatttctcaagcttacgaagttctctctgatgcaaagaaaagggaattatatgacaaaggaggagaacaggcaattaaagagggtggagcaggtggcggttttggctcccccatggacatctttgatatgttttttggaggaggaggaaggatgcagagagaaaggagaggtaaaaatgttgtacatcagctctcagtaaccctagaagacttatataatggtgcaacaagaaaactggctctgcaaaagaatgtgatttgtgacaaatgtgaaggtagaggaggtaagaaaggagcagtagagtgctgtcccaattgccgaggtactggaatgcaaataagaattcatcagataggacctggaatggttcagcaaattcagtctgtgtgcatggagtgccagggccatggggagcggatcagtcctaaagatagatgtaaaagctgcaacggaaggaagatagttcgagagaagaaaattttagaagttcatattgacaaaggcatgaaagatggccagaagataacattccatggtgaaggagaccaagaaccaggactggagccaggcgatattatcattgtgttagatcagaaggaccatgctgtttttactcgacgaggagaagaccttttcatgtgtatggacatacagctcgttgaagcactgtgtggcttccagaagccaatatctactcttgacaaccgaaccatcgtcatcacctctcatccaggtcagattgtcaagcatggagatatcaagtgtgtactaaatgaaggcatgccaatttatcgtagaccatatgaaaagggtcgcctaatcatcgaatttaaggtaaactttcctgagaatggctttctctctcctgataaactgtctttgctggaaaaactcctacccgagaggaaggaagtggaagagactgatgagatggaccaagtagaactggtggactttgatccaaatcaggaaagacggcgccactacaatggagaagcatatgaggatgatgaacatcatcccagaggtggtgttcagtgtcagacctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - V-set and immunoglobulin domain containing 4
- DnaJ (Hsp40) homolog, subfamily A, member 2
- interferon-related developmental regulator 2
- aldehyde dehydrogenase 3 family, member B1

Buy DNAJA1-DnaJ (Hsp40) homolog, subfamily A, member 1 Gene now

Add to cart