Login to display prices
Login to display prices
ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene View larger

ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013584
Product type: DNA & cDNA
Ncbi symbol: ALDH3B1
Origin species: Human
Product name: ALDH3B1-aldehyde dehydrogenase 3 family, member B1 Gene
Size: 2ug
Accessions: BC013584
Gene id: 221
Gene description: aldehyde dehydrogenase 3 family, member B1
Synonyms: ALDH4; aldehyde dehydrogenase family 3 member B1; aldehyde dehydrogenase 3B1; aldehyde dehydrogenase 7; aldehyde dehydrogenase 3 family member B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacccccttggggacacgctgcggcgactgcgggaggccttccacgcggggcgcacgcggccagctgagttccgggctgcgcagctccaaggcctgggccgcttcctgcaagaaaacaagcagcttctgcacgacgcactggcccaggacctgcacaagtcagccttcgagtcggaggtgtctgaggttgccatcagccagggcgaggtcaccctggccctcaggaacctccgggcctggatgaaggacgagcgtgtgcccaagaacctggccacgcagctggactccgccttcatccggaaggagccctttggcctggtcctcatcattgcgccctggaactatccgctgaacctgacgctggtgcccctcgtgggagccctcgctgcagggaactgtgtggtgctgaagccatcggagattagcaagaacgtcgagaagatcctggccgaggtgctgccccaatacgtggaccagagctgctttgctgtggtgctgggcgggccccaggagacggggcagctgctagagcacaggttcgactacatcttcttcacagggagccctcgtgtgggcaagattgttatgactgctgccgccaagcacctgacacctgtcaccctggagctggggggcaagaacccttgctacgtggacgacaactgcgacccccagaccgtggccaaccgcgtggcctggttccgctacttcaacgccggccagacctgcgtggcccccgactacgtcctatgcagccctgagatgcaggagaggctgctgcctgccctgcagagcaccatcacccgtttctatggcgacgacccccagagctccccaaacctgggccgcatcatcaaccagaaacagttccagcggctgcgggcattgctgggctgcggccgtgtggccattgggggccagagcgatgagagcgatcgctacatcgcccccacggtgctggtggatgtgcaggagatggagcctgtgatgcaggaggagatcttcgggcccatcctgcccatcgtgaacgtgcagagcttggacgaggccatcgagttcatcaaccggcgggagaagcccctggccctgtacgccttctccaacagcagccaggtggtcaagcgggtgctgacccagaccagcagcgggggcttctgtgggaacgacggcttcatgcacatgaccctggccagcctgccttttggaggagtgggtgccagtgggatgggccggtaccatggcaagttctccttcgacaccttctcccaccatcgcgcctgcctcctgcgcagcccggggatggagaagctcaacgccctccgctacccgccgcaatcgccgcgccgcctgaggatgctgctggtggccatggaggcccaaggctgcagctgcacactgctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyl CpG binding protein 2 (Rett syndrome)
- aldehyde dehydrogenase 1 family, member A1
- MAP/microtubule affinity-regulating kinase 3
- nuclear factor (erythroid-derived 2)-like 1