MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene View larger

MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene

PTXBC011612

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011612
Product type: DNA & cDNA
Ncbi symbol: MECP2
Origin species: Human
Product name: MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene
Size: 2ug
Accessions: BC011612
Gene id: 4204
Gene description: methyl CpG binding protein 2 (Rett syndrome)
Synonyms: AUTSX3; MRX16; MRX79; MRXS13; MRXSL; PPMX; RTS; RTT; methyl-CpG-binding protein 2; meCp-2 protein; testis tissue sperm-binding protein Li 41a; methyl-CpG binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtagctgggatgttagggctcagggaagaaaagtcagaagaccaggacctccagggcctcaaggacaaacccctcaagtttaaaaaggtgaagaaagataagaaagaagagaaagagggcaagcatgagcccgtgcagccatcagcccaccactctgctgagcccgcagaggcaggcaaagcagagacatcagaagggtcaggctccgccccggctgtgccggaagcttctgcctcccccaaacagcggcgctccatcatccgtgaccggggacccatgtatgatgaccccaccctgcctgaaggctggacacggaagcttaagcaaaggaaatctggccgctctgctgggaagtatgatgtgtatttgatcaatccccagggaaaagcctttcgctctaaagtggagttgattgcgtacttcgaaaaggtaggcgacacatccctggaccctaatgattttgacttcacggtaactgggagagggagcccctcccggcgagagcagaaaccacctaagaagcccaaatctcccaaagctccaggaactggcagaggccggggacgccccaaagggagcggcaccacgagacccaaggcggccacgtcagagggtgtgcaggtgaaaagggtcctggagaaaagtcctgggaagctccttgtcaagatgccttttcaaacttcgccagggggcaaggctgaggggggtggggccaccacatccacccaggtcatggtgatcaaacgccccggcaggaagcgaaaagctgaggccgaccctcaggccattcccaagaaacggggccgaaagccggggagtgtggtggcagccgctgccgccgaggccaaaaagaaagccgtgaaggagtcttctatccgatctgtgcaggagaccgtactccccatcaagaagcgcaagacccgggagacggtcagcatcgaggtcaaggaagtggtgaagcccctgctggtgtccaccctcggtgagaagagcgggaaaggactgaagacctgtaagagccctgggcggaaaagcaaggagagcagccccaaggggcgcagcagcagcgcctcctcaccccccaagaaggagcaccaccaccatcaccaccactcagagtccccaaaggcccccgtgccactgctcccacccctgcccccacctccacctgagcccgagagctccgaggaccccaccagcccccctgagccccaggacttgagcagcagcgtctgcaaagaggagaagatgcccagaggaggctcactggagagcgacggctgccccaaggagccagctaagactcagcccgcggttgccaccgccgccacggccgcagaaaagtacaaacaccgaggggagggagagcgcaaagacattgtttcatcctccatgccaaggccaaacagagaggagcctgtggacagccggacgcccgtgaccgagagagttagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 1 family, member A1
- MAP/microtubule affinity-regulating kinase 3
- nuclear factor (erythroid-derived 2)-like 1
- similar to bovine IgA regulatory protein

Buy MECP2-methyl CpG binding protein 2 (Rett syndrome) Gene now

Add to cart