Login to display prices
Login to display prices
ALDH1A1-aldehyde dehydrogenase 1 family, member A1 Gene View larger

ALDH1A1-aldehyde dehydrogenase 1 family, member A1 Gene

PTXBC001505

New product

Data sheet of ALDH1A1-aldehyde dehydrogenase 1 family, member A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALDH1A1-aldehyde dehydrogenase 1 family, member A1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001505
Ncbi symbol: ALDH1A1
Product name: ALDH1A1-aldehyde dehydrogenase 1 family, member A1 Gene
Size: 2ug
Accessions: BC001505
Gene id: 216
Gene description: aldehyde dehydrogenase 1 family, member A1
Synonyms: ALDC; ALDH-E1; ALDH1; ALDH11; HEL-9; HEL-S-53e; HEL12; PUMB1; RALDH1; retinal dehydrogenase 1; ALDH class 1; ALHDII; RALDH 1; acetaldehyde dehydrogenase 1; aldehyde dehydrogenase 1, soluble; aldehyde dehydrogenase, liver cytosolic; epididymis luminal protein 12; epididymis luminal protein 9; epididymis secretory sperm binding protein Li 53e; retinaldehyde dehydrogenase 1; aldehyde dehydrogenase 1 family member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcatcctcaggcacgccagacttacctgtcctactcaccgatttgaagattcaatatactaagatcttcataaacaatgaatggcatgattcagtgagtggcaagaaatttcctgtctttaatcctgcaactgaggaggagctctgccaggtagaagaaggagataaggaggatgttgacaaggcagtgaaggccgcaagacaggcttttcagattggatccccgtggcgtactatggatgcttccgagagggggcgactattatacaagttggctgatttaatcgaaagagatcgtctgctgctggcgacaatggagtcaatgaatggtggaaaactctattccaatgcatatctgaatgatttagcaggctgcatcaaaacattgcgctactgtgcaggttgggctgacaagatccagggccgtacaataccaattgatggaaatttttttacatatacaagacatgaacctattggtgtatgtggccaaatcattccttggaatttcccgttggttatgctcatttggaagatagggcctgcactgagctgtggaaacacagtggttgtcaaaccagcagagcaaactcctctcactgctctccacgtggcatctttaataaaagaggcagggtttcctcctggagtagtgaatattgttcctggttatgggcctacagcaggggcagccatttcttctcacatggatatagacaaagtagccttcacaggatcaacagaggttggcaagttgatcaaagaagctgccgggaaaagcaatctgaagagggtgaccctggagcttggaggaaagagcccttgcattgtgttagctgatgccgacttggacaatgctgttgaatttgcacaccatggggtattctaccaccagggccagtgttgtatagccgcatccaggatttttgtggaagaatcaatttatgatgagtttgttcgaaggagtgttgagcgggctaagaagtatatccttggaaatcctctgaccccaggagtcactcaaggccctcagattgacaaggaacaatatgataaaatacttgacctcattgagagtgggaagaaagaaggggccaaactggaatgtggaggaggcccgtgggggaataaaggctactttgtccagcccacagtgttctctaatgttacagatgagatgcgcattgccaaagaggagatttttggaccagtgcagcaaatcatgaagtttaaatctttagatgacgtgatcaaaagagcaaacaatactttctatggcttatcagcaggagtgtttaccaaagacattgataaagccataacaatctcctctgctctgcaggcaggaacagtgtgggtgaattgctatggcgtggtaagtgcccagtgcccctttggtggattcaagatgtctggaaatggaagagaactgggagagtacggtttccatgaatatacagaggtcaaaacagtcacagtgaaaatctctcagaagaactcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: