Login to display prices
Login to display prices
PITPNB-phosphatidylinositol transfer protein, beta Gene View larger

PITPNB-phosphatidylinositol transfer protein, beta Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PITPNB-phosphatidylinositol transfer protein, beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PITPNB-phosphatidylinositol transfer protein, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018704
Product type: DNA & cDNA
Ncbi symbol: PITPNB
Origin species: Human
Product name: PITPNB-phosphatidylinositol transfer protein, beta Gene
Size: 2ug
Accessions: BC018704
Gene id: 23760
Gene description: phosphatidylinositol transfer protein, beta
Synonyms: PI-TP-beta; PtdInsTP; VIB1B; phosphatidylinositol transfer protein beta isoform; PtdIns transfer protein beta; phosphotidylinositol transfer protein, beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgctgatcaaggaattccgtgtggttttgccatgttctgttcaggagtatcaggttgggcagctttactctgttgcagaagctagtaagaatgagactggtggtggagaaggaattgaagtcttaaagaatgaaccttatgagaaggatggagaaaagggacagtatacgcacaaaatttatcacctaaagagcaaagtgcctgcattcgtgaggatgattgctcccgagggctccttggtgtttcatgagaaagcctggaatgcgtacccctactgtagaacaattgtaacgaatgaatatatgaaagatgatttcttcattaaaatcgaaacatggcacaaaccagacttgggaacattagaaaatgtacatggtttagatccaaacacatggaaaactgttgaaattgtccatatagatattgcagatagaagtcaagttgaaccagcagactacaaagctgatgaagacccagcattattccagtcagtcaagaccaagagaggccctttgggacccaactggaagaaggagctggcaaacagccctgactgtccccagatgtgtgcctataagctggtgaccatcaaattcaagtggtggggactgcaaagcaaagtagaaaacttcattcaaaagcaagaaaaacggatatttacaaacttccatcgccagcttttttgttggattgacaagtggatcgatctcacgatggaagacattaggagaatggaagacgagactcagaaagaactagaaacaatgcgtaagaggggttccgttcgaggcacgtcggctgctgatgtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 11
- DnaJ (Hsp40) homolog, subfamily B, member 2
- major histocompatibility complex, class I, A
- major histocompatibility complex, class I, A