Login to display prices
Login to display prices
ALKBH8-alkB, alkylation repair homolog 8 (E. coli) Gene View larger

ALKBH8-alkB, alkylation repair homolog 8 (E. coli) Gene

PTXBC015183

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALKBH8-alkB, alkylation repair homolog 8 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALKBH8-alkB, alkylation repair homolog 8 (E. coli) Gene

Proteogenix catalog: PTXBC015183
Ncbi symbol: ALKBH8
Product name: ALKBH8-alkB, alkylation repair homolog 8 (E. coli) Gene
Size: 2ug
Accessions: BC015183
Gene id: 91801
Gene description: alkB, alkylation repair homolog 8 (E. coli)
Synonyms: ABH8; TRM9; TRMT9; alkylated DNA repair protein alkB homolog 8; AlkB homologue 8; S-adenosyl-L-methionine-dependent tRNA methyltransferase ABH8; alkB, alkylation repair homolog 8; tRNA (carboxymethyluridine(34)-5-O)-methyltransferase ABH8; tRNA methyltransferase 9 homolog; alkB homolog 8, tRNA methyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagcaaccatcaaagtaattacaaactcagtaaaactgagaagaagttcttaaggaaacagattaaagccaagcatactttgctgagacatgaaggcattgagacagtatcctatgccactcagagcctggttgttgccaatggtggtttgggtaatggtgtgagtcggaaccagctgctcccggttttagagaaatgtggactggtggatgctctcttaatgccacctaacaagccgtactcatttgcaagatacagaactacagaagaatctaagagagcctatgttaccctcaatggaaaagaagtagtggatgatttaggacaaaagatcactctgtatttgaattttgtggaaaaagtgcagtggaaggagttgaggcctcaagccttaccaccaggactcatggtagtagaagaaataatttcttctgaggaggagaaaatgcttttggaaagtgttgattggacagaagatacagacaatcaaaactctcaaaaatccttaaaacacagaagagtaaagcattttggttatgagttccactatgagaacaacaatgtagataaagataagccattatctgggggtcttcctgacatttgtgaaagctttttggagaaatggttgaggaaaggttacattaaacataaacctgatcaaatgaccataaatcagtatgaacctgggcaagattgtcatggattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: