SOD2-superoxide dismutase 2, mitochondrial Gene View larger

SOD2-superoxide dismutase 2, mitochondrial Gene

PTXBC012423

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOD2-superoxide dismutase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SOD2-superoxide dismutase 2, mitochondrial Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012423
Product type: DNA & cDNA
Ncbi symbol: SOD2
Origin species: Human
Product name: SOD2-superoxide dismutase 2, mitochondrial Gene
Size: 2ug
Accessions: BC012423
Gene id: 6648
Gene description: superoxide dismutase 2, mitochondrial
Synonyms: IPO-B; IPOB; MNSOD; MVCD6; Mn-SOD; superoxide dismutase [Mn], mitochondrial; Mn superoxide dismutase; indophenoloxidase B; manganese-containing superoxide dismutase; mangano-superoxide dismutase; superoxide dismutase 2, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgagccgggcagtgtgcggcaccagcaggcagctggctccggttttggggtatctgggctccaggcagaagcacagcctccccgacctgccctacgactacggcgccctggaacctcacatcaacgcgcagatcatgcagctgcaccacagcaagcaccacgcggcctacgtgaacaacctgaacgtcaccgaggagaagtaccaggaggcgttggccaagggagatgttacagcccagatagctcttcagcctgcactgaagttcaatggtggtggtcatatcaatcatagcattttctggacaaacctcagccctaacggtggtggagaacccaaaggggagttgctggaagccatcaaacgtgactttggttcctttgacaagtttaaggagaagctgacggctgcatctgttggtgtccaaggctcaggttggggttggcttggtttcaataaggaacggggacacttacaaattgctgcttgtccaaatcaggatccactgcaaggaacaacaggccttattccactgctggggattgatgtgtgggagcacgcttactaccttcagtataaaaatgtcaggcctgattatctaaaagctatttggaatgtaatcaactgggagaatgtaactgaaagatacatggcttgcaaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 49
- GLI pathogenesis-related 1 like 1
- chromosome 7 open reading frame 29
- chromosome 4 open reading frame 18

Buy SOD2-superoxide dismutase 2, mitochondrial Gene now

Add to cart