Login to display prices
Login to display prices
SOD2-superoxide dismutase 2, mitochondrial Gene View larger

SOD2-superoxide dismutase 2, mitochondrial Gene

PTXBC012423

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOD2-superoxide dismutase 2, mitochondrial Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SOD2-superoxide dismutase 2, mitochondrial Gene

Proteogenix catalog: PTXBC012423
Ncbi symbol: SOD2
Product name: SOD2-superoxide dismutase 2, mitochondrial Gene
Size: 2ug
Accessions: BC012423
Gene id: 6648
Gene description: superoxide dismutase 2, mitochondrial
Synonyms: IPO-B; IPOB; MNSOD; MVCD6; Mn-SOD; superoxide dismutase [Mn], mitochondrial; Mn superoxide dismutase; indophenoloxidase B; manganese-containing superoxide dismutase; mangano-superoxide dismutase; superoxide dismutase 2, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgagccgggcagtgtgcggcaccagcaggcagctggctccggttttggggtatctgggctccaggcagaagcacagcctccccgacctgccctacgactacggcgccctggaacctcacatcaacgcgcagatcatgcagctgcaccacagcaagcaccacgcggcctacgtgaacaacctgaacgtcaccgaggagaagtaccaggaggcgttggccaagggagatgttacagcccagatagctcttcagcctgcactgaagttcaatggtggtggtcatatcaatcatagcattttctggacaaacctcagccctaacggtggtggagaacccaaaggggagttgctggaagccatcaaacgtgactttggttcctttgacaagtttaaggagaagctgacggctgcatctgttggtgtccaaggctcaggttggggttggcttggtttcaataaggaacggggacacttacaaattgctgcttgtccaaatcaggatccactgcaaggaacaacaggccttattccactgctggggattgatgtgtgggagcacgcttactaccttcagtataaaaatgtcaggcctgattatctaaaagctatttggaatgtaatcaactgggagaatgtaactgaaagatacatggcttgcaaaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: