RAG1AP1-recombination activating gene 1 activating protein 1 Gene View larger

RAG1AP1-recombination activating gene 1 activating protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAG1AP1-recombination activating gene 1 activating protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAG1AP1-recombination activating gene 1 activating protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005943
Product type: DNA & cDNA
Ncbi symbol: RAG1AP1
Origin species: Human
Product name: RAG1AP1-recombination activating gene 1 activating protein 1 Gene
Size: 2ug
Accessions: BC005943
Gene id: 55974
Gene description: recombination activating gene 1 activating protein 1
Synonyms: RAG1AP1; HsSWEET1; SCP; SWEET1; slv; sugar transporter SWEET1; RAG1-activating protein 1; RP11-540D14.5; RZPDo834D038D; recombination activating gene 1 activating protein 1; solute carrier family 50 (sugar efflux transporter), member 1; solute carrier family 50 (sugar transporter), member 1; stromal cell protein; solute carrier family 50 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgggcggctttctggactcgctcatttacggagcatgcgtggtcttcacccttggcatgttctccgccggcctctcggacctcaggcacatgcgaatgacccggagtgtggacaacgtccagttcctgccctttctcaccacggaagtcaacaacctgggctggctgagttatggggctttgaagggagacgggatcctcatcgtcgtcaacacagtgggtgctgcgcttcagaccctgtatatcttggcatatctgcattactgccctcggaagcgtgttgtgctcctacagactgcaaccctgctaggggtccttctcctgggttatggctacttttggctcctggtacccaaccctgaggcccggcttcagcagttgggcctcttctgcagtgtcttcaccatcagcatgtacctctcaccactggctgacttggctaaggtgattcaaactaaatcaacccaatgtctctcctacccactcaccattgctacccttctcacctctgcctcctggtgcctctatgggtttcgactcagagatccctatatcatggtgtccaactttccaggaatcgtcaccagctttatccgcttctggcttttctggaagtacccccaggagcaagacaggaactactggctcctgcaaacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)
- cyclin-dependent kinase 5, regulatory subunit 1 (p35)
- calcium binding tyrosine-(Y)-phosphorylation regulated
- proteasome (prosome, macropain) 26S subunit, ATPase, 4

Buy RAG1AP1-recombination activating gene 1 activating protein 1 Gene now

Add to cart