Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAG1AP1-recombination activating gene 1 activating protein 1 Gene
PTXBC005943
New product
Data sheet of RAG1AP1-recombination activating gene 1 activating protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAG1AP1-recombination activating gene 1 activating protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005943 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAG1AP1 |
| Origin species: | Human |
| Product name: | RAG1AP1-recombination activating gene 1 activating protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC005943 |
| Gene id: | 55974 |
| Gene description: | recombination activating gene 1 activating protein 1 |
| Synonyms: | RAG1AP1; HsSWEET1; SCP; SWEET1; slv; sugar transporter SWEET1; RAG1-activating protein 1; RP11-540D14.5; RZPDo834D038D; recombination activating gene 1 activating protein 1; solute carrier family 50 (sugar efflux transporter), member 1; solute carrier family 50 (sugar transporter), member 1; stromal cell protein; solute carrier family 50 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgggcggctttctggactcgctcatttacggagcatgcgtggtcttcacccttggcatgttctccgccggcctctcggacctcaggcacatgcgaatgacccggagtgtggacaacgtccagttcctgccctttctcaccacggaagtcaacaacctgggctggctgagttatggggctttgaagggagacgggatcctcatcgtcgtcaacacagtgggtgctgcgcttcagaccctgtatatcttggcatatctgcattactgccctcggaagcgtgttgtgctcctacagactgcaaccctgctaggggtccttctcctgggttatggctacttttggctcctggtacccaaccctgaggcccggcttcagcagttgggcctcttctgcagtgtcttcaccatcagcatgtacctctcaccactggctgacttggctaaggtgattcaaactaaatcaacccaatgtctctcctacccactcaccattgctacccttctcacctctgcctcctggtgcctctatgggtttcgactcagagatccctatatcatggtgtccaactttccaggaatcgtcaccagctttatccgcttctggcttttctggaagtacccccaggagcaagacaggaactactggctcctgcaaacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - calcium binding tyrosine-(Y)-phosphorylation regulated - proteasome (prosome, macropain) 26S subunit, ATPase, 4 |