Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene
PTXBC026347
New product
Data sheet of CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026347 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDK5R1 |
| Origin species: | Human |
| Product name: | CDK5R1-cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene |
| Size: | 2ug |
| Accessions: | BC026347 |
| Gene id: | 8851 |
| Gene description: | cyclin-dependent kinase 5, regulatory subunit 1 (p35) |
| Synonyms: | CDK5P35; CDK5R; NCK5A; p23; p25; p35; p35nck5a; cyclin-dependent kinase 5 activator 1; CDK5 activator 1; TPKII regulatory subunit; neuronal CDK5 activator; regulatory partner for CDK5 kinase; tau protein kinase II 23kDa subunit; cyclin dependent kinase 5 regulatory subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcacggtgctgtccctgtctcccagctaccggaaggccacgctgtttgaggatggcgcggccaccgtgggccactatacggccgtacagaacagcaagaacgccaaggacaagaacctgaagcgccactccatcatctccgtgctgccttggaagagaatcgtggccgtgtcggccaagaagaagaactccaagaaggtgcagcccaacagcagctaccagaacaacatcacgcacctcaacaatgagaacctgaagaagtcgctgtcatgcgccaacctgtccacattcgcccagcccccaccggcccagccgcctgcacccccggccagccagctctcgggttcccagaccgggggctcctcctcagtcaagaaagcccctcaccctgccgtcacctccgcagggacgcccaaacgggtcatcgtccaggcgtccaccagtgagctgcttcgctgcctgggtgagtttctctgccgccggtgctaccgcctgaagcacctgtcccccacggaccccgtgctctggctgcgcagcgtggaccgctcgctgcttctgcagggctggcaggaccagggcttcatcacgccggccaacgtggtcttcctctacatgctctgcagggatgttatctcctccaaggtgggctcggatcacgagctccaggccgtcctgctgacatgcctgtacctctcctactcctacatgggcaacgagatctcctacccgctcaagcccttcctggtggagagctgcaaggaggccttttgggaccgttgcctctctgtcatcaacctcatgagctcaaagatgctgcagataaatgccgacccacactacttcacacaggtcttctccgacctgaagaacgagagcggccaggaggacaagaagcggctcctcctaggcctggatcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - calcium binding tyrosine-(Y)-phosphorylation regulated - proteasome (prosome, macropain) 26S subunit, ATPase, 4 - proteasome (prosome, macropain) 26S subunit, ATPase, 6 - tRNA splicing endonuclease 34 homolog (S. cerevisiae) |