Login to display prices
Login to display prices
PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene View larger

PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010396
Product type: DNA & cDNA
Ncbi symbol: PSMC4
Origin species: Human
Product name: PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene
Size: 2ug
Accessions: BC010396
Gene id: 5704
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 4
Synonyms: MIP224; RPT3; TBP-7; TBP7; 26S protease regulatory subunit 6B; 26S proteasome AAA-ATPase subunit RPT3; MB67-interacting protein; Tat-binding protein 7; protease 26S subunit 6; proteasome (prosome, macropain) 26S subunit, ATPase, 4; proteasome 26S subunit, ATPase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagataggcatcttggtggagaaggctcaggatgagatcccagcactgtccgtgtcccggccccagaccggcctgtccttcctgggccctgagcctgaggacctggaggacctgtacagccgctacaaggaggaggtgaagcgaatccaaagcatcccgctggtcatcggacaatttctggaggctgtggatcagaatacagccatcgtgggctctaccacaggctccaactattatgtgcgcatcctgagcaccatcgatcgggagctgctcaagcccaacgcctcagtggccctccacaagcacagcaatgcactggtggacgtgctgccccccgaagccgacagcagcatcatgatgctcacctcagaccagaagccagatgtgatgtacgcggacatcggaggcatggacatccagaagcaggaggtgcgggaggccgtggagctcccgctcacgcatttcgagctctacaagcagatcggcatcgatcccccccgaggcgtcctcatgtatggcccacctggctgtgggaagaccatgttggcaaaggcggtggcacatcacacaacagctgcattcatccgggtcgtgggctcggagtttgtacagaagtatctgggtgagggcccccgcatggtccgggatgtgttccgcctggccaaggagaatgcacctgccatcatcttcatagacgagattgatgccatcgccaccaagagattcgatgctcagacaggggccgacagggaggttcagaggatcctgctggagctgctgaatcagatggatggatttgatcagaatgtcaatgtcaaggtaatcatggccacaaacagagcagacaccctggatccggccctgctacggccaggacggctggaccgtaaaattgaatttccacttcctgaccgccgccagaagagattgattttctccactatcactagcaagatgaacctctctgaggaggttgacttggaagactatgtggcccggccagataagatttcaggagctgatattaactccatctgtcaggagagtggaatgttggctgtccgtgaaaaccgctacattgtcctggccaaggacttcgagaaagcatacaagactgtcatcaagaaggacgagcaggagcatgagttttacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, ATPase, 6
- tRNA splicing endonuclease 34 homolog (S. cerevisiae)
- RGP1 retrograde golgi transport homolog (S. cerevisiae)
- Bernardinelli-Seip congenital lipodystrophy 2 (seipin)