Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene
PTXBC010396
New product
Data sheet of PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010396 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMC4 |
| Origin species: | Human |
| Product name: | PSMC4-proteasome (prosome, macropain) 26S subunit, ATPase, 4 Gene |
| Size: | 2ug |
| Accessions: | BC010396 |
| Gene id: | 5704 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, ATPase, 4 |
| Synonyms: | MIP224; RPT3; TBP-7; TBP7; 26S protease regulatory subunit 6B; 26S proteasome AAA-ATPase subunit RPT3; MB67-interacting protein; Tat-binding protein 7; protease 26S subunit 6; proteasome (prosome, macropain) 26S subunit, ATPase, 4; proteasome 26S subunit, ATPase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagataggcatcttggtggagaaggctcaggatgagatcccagcactgtccgtgtcccggccccagaccggcctgtccttcctgggccctgagcctgaggacctggaggacctgtacagccgctacaaggaggaggtgaagcgaatccaaagcatcccgctggtcatcggacaatttctggaggctgtggatcagaatacagccatcgtgggctctaccacaggctccaactattatgtgcgcatcctgagcaccatcgatcgggagctgctcaagcccaacgcctcagtggccctccacaagcacagcaatgcactggtggacgtgctgccccccgaagccgacagcagcatcatgatgctcacctcagaccagaagccagatgtgatgtacgcggacatcggaggcatggacatccagaagcaggaggtgcgggaggccgtggagctcccgctcacgcatttcgagctctacaagcagatcggcatcgatcccccccgaggcgtcctcatgtatggcccacctggctgtgggaagaccatgttggcaaaggcggtggcacatcacacaacagctgcattcatccgggtcgtgggctcggagtttgtacagaagtatctgggtgagggcccccgcatggtccgggatgtgttccgcctggccaaggagaatgcacctgccatcatcttcatagacgagattgatgccatcgccaccaagagattcgatgctcagacaggggccgacagggaggttcagaggatcctgctggagctgctgaatcagatggatggatttgatcagaatgtcaatgtcaaggtaatcatggccacaaacagagcagacaccctggatccggccctgctacggccaggacggctggaccgtaaaattgaatttccacttcctgaccgccgccagaagagattgattttctccactatcactagcaagatgaacctctctgaggaggttgacttggaagactatgtggcccggccagataagatttcaggagctgatattaactccatctgtcaggagagtggaatgttggctgtccgtgaaaaccgctacattgtcctggccaaggacttcgagaaagcatacaagactgtcatcaagaaggacgagcaggagcatgagttttacaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, ATPase, 6 - tRNA splicing endonuclease 34 homolog (S. cerevisiae) - RGP1 retrograde golgi transport homolog (S. cerevisiae) - Bernardinelli-Seip congenital lipodystrophy 2 (seipin) |