Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene
PTXBC011996
New product
Data sheet of CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011996 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CABYR |
| Origin species: | Human |
| Product name: | CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene |
| Size: | 2ug |
| Accessions: | BC011996 |
| Gene id: | 26256 |
| Gene description: | calcium binding tyrosine-(Y)-phosphorylation regulated |
| Synonyms: | CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2; calcium-binding tyrosine phosphorylation-regulated protein; calcium binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2); calcium-binding protein 86; cancer/testis antigen 88; fibrousheathin II; fibrousheathin-2; testis tissue sperm-binding protein Li 84P; testis-specific calcium-binding protein CBP86; calcium binding tyrosine phosphorylation regulated |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctggttaaacaatttcatcagattaaagtagagaaatggtcagaaggaacgacaccacagaagaaattagaatgtttaaaagaaccaggaaaaacatctgtagaatctaaagtacctacccagatggaaaaatctacagacacagacgaggacaatgtaaccagaacagaatatagtgacaaaaccacccagtttccatcagtttatgctgtgccaggcactgagcaaacggaagcagttggtggtctttcttccaaaccagccacccctaagactactaccccaccctcatcaccacctccaacagctgtctcaccagagtttgcctacgtcccagctgacccagctcagcttgctgctcagatgttagcaatggcaacaagtgaacgaggacaaccaccaccatgttctaacatgtggaccctttattgtctaactgataagaatcaacaaggtcacccatcaccgccacctgcacctgggccttttccccaagcaaccctctatttacctaatcctaaggatccacagtttcagcagcatccaccaaaagtcacttttccaacttatgtgatgggcgacaccaagaagaccagtgccccaccttttatcttagtaggctcaaatgttcaggaagcacagggatggaaacctcttcccggacatgctgtcgtttcacagtcagatgtcttgagatatgttgcaatgcaagtgcccattgctgttcctgcagatgagaaataccagaaacataccctaagtccccagaatgctaatcctccaagtggacaagatgtccccaggccaaaaagccctgttttcctttctgttgctttcccagtagaagatgtagctaaaaaaagttcaggatctggtgacaaatgtgctccctttggaagttacggtattgctggggaggtaaccgtgactactgctcacaaacgtcgcaaagcagaaactgaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, ATPase, 4 - proteasome (prosome, macropain) 26S subunit, ATPase, 6 - tRNA splicing endonuclease 34 homolog (S. cerevisiae) - RGP1 retrograde golgi transport homolog (S. cerevisiae) |