CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene View larger

CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene

PTXBC011996

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011996
Product type: DNA & cDNA
Ncbi symbol: CABYR
Origin species: Human
Product name: CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene
Size: 2ug
Accessions: BC011996
Gene id: 26256
Gene description: calcium binding tyrosine-(Y)-phosphorylation regulated
Synonyms: CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2; calcium-binding tyrosine phosphorylation-regulated protein; calcium binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2); calcium-binding protein 86; cancer/testis antigen 88; fibrousheathin II; fibrousheathin-2; testis tissue sperm-binding protein Li 84P; testis-specific calcium-binding protein CBP86; calcium binding tyrosine phosphorylation regulated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctggttaaacaatttcatcagattaaagtagagaaatggtcagaaggaacgacaccacagaagaaattagaatgtttaaaagaaccaggaaaaacatctgtagaatctaaagtacctacccagatggaaaaatctacagacacagacgaggacaatgtaaccagaacagaatatagtgacaaaaccacccagtttccatcagtttatgctgtgccaggcactgagcaaacggaagcagttggtggtctttcttccaaaccagccacccctaagactactaccccaccctcatcaccacctccaacagctgtctcaccagagtttgcctacgtcccagctgacccagctcagcttgctgctcagatgttagcaatggcaacaagtgaacgaggacaaccaccaccatgttctaacatgtggaccctttattgtctaactgataagaatcaacaaggtcacccatcaccgccacctgcacctgggccttttccccaagcaaccctctatttacctaatcctaaggatccacagtttcagcagcatccaccaaaagtcacttttccaacttatgtgatgggcgacaccaagaagaccagtgccccaccttttatcttagtaggctcaaatgttcaggaagcacagggatggaaacctcttcccggacatgctgtcgtttcacagtcagatgtcttgagatatgttgcaatgcaagtgcccattgctgttcctgcagatgagaaataccagaaacataccctaagtccccagaatgctaatcctccaagtggacaagatgtccccaggccaaaaagccctgttttcctttctgttgctttcccagtagaagatgtagctaaaaaaagttcaggatctggtgacaaatgtgctccctttggaagttacggtattgctggggaggtaaccgtgactactgctcacaaacgtcgcaaagcagaaactgaaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, ATPase, 4
- proteasome (prosome, macropain) 26S subunit, ATPase, 6
- tRNA splicing endonuclease 34 homolog (S. cerevisiae)
- RGP1 retrograde golgi transport homolog (S. cerevisiae)

Buy CABYR-calcium binding tyrosine-(Y)-phosphorylation regulated Gene now

Add to cart