Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene
PTXBC038830
New product
Data sheet of SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038830 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNF8 |
| Origin species: | Human |
| Product name: | SNF8-SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC038830 |
| Gene id: | 11267 |
| Gene description: | SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) |
| Synonyms: | SNF8, ESCRT-II complex subunit; SNF8, ESCRT-II complex subunit, homolog; vacuolar-sorting protein SNF8; Dot3; EAP30; VPS22; EAP30 subunit of ELL complex; ELL-associated protein of 30 kDa; ESCRT-II complex subunit VPS22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaccgccgcggggtgggagctggcgccatcgccaagaagaaacttgcagaggccaagtataaggagcgagggacggtcttggctgaggaccagctagcccagatgtcaaagcagttggacatgttcaagaccaacctggaggaatttgccagcaaacacaagcaggagatccggaagaatcctgagttccgtgtgcagttccaggacatgtgtgcaaccattggcgtggatccgctggcctctggaaaaggattttggtctgagatgctgggcgtgggggacttctattacgaactaggtgtccaaattatcgaagtgtgcctggcgctgaagcatcggaatggaggtctgataactttggaggaactacatcaacaggtgttgaagggaaggggcaagttcgcccaggatgtcagtcaagatgacctgatcagagccatcaagaaactaaaggcacttggcactggcttcggcatcatccctgtgggcggcacttacctcattcagtctgttccagctgagctcaatatggatcacaccgtggtgctgcagctggcagagaatggctacgtgactgtcagtgagatcaaagccagtcttaaatgggagaccgagcgagcgcggcaagtgctggaacacctgctgaaggaagggttggcgtggctggacttacaggccccaggggaggcccactactggctgccagctctcttcactgacctctactcccaggagattacagctgaggaggccagagaagccctcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase 5, regulatory subunit 1 (p35) - calcium binding tyrosine-(Y)-phosphorylation regulated - proteasome (prosome, macropain) 26S subunit, ATPase, 4 - proteasome (prosome, macropain) 26S subunit, ATPase, 6 |