PRELID1-PRELI domain containing 1 Gene View larger

PRELID1-PRELI domain containing 1 Gene

PTXBC000007

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRELID1-PRELI domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRELID1-PRELI domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000007
Product type: DNA & cDNA
Ncbi symbol: PRELID1
Origin species: Human
Product name: PRELID1-PRELI domain containing 1 Gene
Size: 2ug
Accessions: BC000007
Gene id: 27166
Gene description: PRELI domain containing 1
Synonyms: CGI-106; PX19; SBBI12; PRELI domain-containing protein 1, mitochondrial; 25 kDa protein of relevant evolutionary and lymphoid interest; px19-like protein; PRELI domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaagtatttcctgggccagagcgtgctccggagttcctgggaccaagtgttcgccgccttctggcagcggtacccgaatccctatagcaaacatgtcttgacggaagacatagtacaccgggaggtgacccctgaccagaaactgctgtcccggcgactcctgaccaagaccaacaggatgccacgctgggccgagcgactatttcctgccaatgttgctcactcggtgtacgtcctggaggactctattgtggacccacagaatcagaccatgactaccttcacctggaacatcaaccacgcccggctgatggtggtggaggaacgatgtgtttactgtgtgaactctgacaacagtggctggactgaaatccgccgggaagcctgggtctcctctagcttatttggtgtctccagagctgtccaggaatttggtcttgcccggttcaaaagcaacgtgaccaagactatgaagggttttgaatatatcttggctaagctgcaaggcgaggccccttccaaaacacttgttgagacagccaaggaagccaaggagaaggcaaaggagacggcactggcagctacagagaaggccaaggacctcgccagcaaggcggccaccaagaagcagcagcagcagcaacagtttgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 86B
- Epstein-Barr virus induced 3
- exocyst complex component 7
- transmembrane protein 109

Buy PRELID1-PRELI domain containing 1 Gene now

Add to cart