MAGEH1-melanoma antigen family H, 1 Gene View larger

MAGEH1-melanoma antigen family H, 1 Gene

PTXBC011954

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEH1-melanoma antigen family H, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEH1-melanoma antigen family H, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011954
Product type: DNA & cDNA
Ncbi symbol: MAGEH1
Origin species: Human
Product name: MAGEH1-melanoma antigen family H, 1 Gene
Size: 2ug
Accessions: BC011954
Gene id: 28986
Gene description: melanoma antigen family H, 1
Synonyms: APR-1; APR1; MAGEH; melanoma-associated antigen H1; apoptosis-related protein 1; melanoma antigen family H, 1; melanoma antigen family H1; restin; MAGE family member H1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcggggacgaaagagtcggcgccgccgtaatgcgagagccgcagaagagaaccgcaacaatcgcaaaatccaggcctcagaggcctccgagacccctatggccgcctctgtggtagcgagcacccccgaagacgacctgagcggccccgaggaagacccgagcactccagaggaggcctctaccacccctgaagaagcctcgagcactgcccaagcacaaaagccttcagtgccccggagcaattttcagggcaccaagaaaagtctcctgatgtctatattagcgctcatcttcatcatgggcaacagcgccaaggaagctctggtctggaaagtgctggggaagttaggaatgcagcctggacgtcagcacagcatctttggagatccgaagaagatcgtcacagaagagtttgtgcgcagagggtacctgatttataaaccggtgccccgtagcagtccggtggagtatgagttcttctgggggccccgagcacacgtggaatcgagcaaactgaaagtcatgcattttgtggcaagggttcgtaaccgatgctctaaagactggccttgtaattatgactgggattcggacgatgatgcagaggttgaggctatcctcaattcaggtgctaggggttattccgccccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NIPA-like domain containing 3
- ubiquitin domain containing 1
- ribose 5-phosphate isomerase A
- tweety homolog 1 (Drosophila)

Buy MAGEH1-melanoma antigen family H, 1 Gene now

Add to cart