TTYH1-tweety homolog 1 (Drosophila) Gene View larger

TTYH1-tweety homolog 1 (Drosophila) Gene

PTXBC019358

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTYH1-tweety homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTYH1-tweety homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019358
Product type: DNA & cDNA
Ncbi symbol: TTYH1
Origin species: Human
Product name: TTYH1-tweety homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC019358
Gene id: 57348
Gene description: tweety homolog 1 (Drosophila)
Synonyms: protein tweety homolog 1; hTTY1; tweety homolog 1; tweety family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggctggcctacgtcctcctgctgctcctggagctgctggtctgcctcttcaccctcctgggcctggcgaagcagagcaagtggctggtgatcgtgatgacagtcatgagtctcctggttctcgtcctgagctggggctccatgggcctggaggcagccacggccgtgggcctcagtgacttctgctccaatccagacccttatgttctgaacctgacccaggaggagacagggctcagctcagacatcctgagctattatctcctctgcaaccgggccgtctccaaccccttccaacagaggctgactctgtcccagcgagctctggccaacatccactcccagctgctgggcctggagcgagaagctgtgcctcagttcccttcagcgcagaagcctctgctgtccttggaggagactctgaatgtgacagaaggaaatttccaccagttggtggcactgctacactgccgcagcctgcacaaggactatggtgcagccctgcggggcctgtgcgaagacgccctggaaggcctgctcttcctgctgctcttctccctgctgtctgcaggagcgctggccactgccctctgcagcctgccccgagcctgggccctcttcccacccagtgacgactacgatgacacagacgatgacgaccctttcaaccctcagcaggaatccaagcgctttgtgcagtggcagtcgtctatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - unc-119 homolog (C. elegans)
- kallikrein-related peptidase 6
- angel homolog 2 (Drosophila)
- transmembrane protein 106A

Buy TTYH1-tweety homolog 1 (Drosophila) Gene now

Add to cart