Cart 5 Product Products 583,20 € (empty)
-
1 x ADAMTSL4-A...121,50 € -
1 x CCDC26-coi...113,40 € -
1 x MGC5566-hy...113,40 € -
1 x CXCL5-chem...113,40 € -
1 x ATXN7L3-at...121,50 €
No products
To be determined Shipping
583,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 583,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 583,20 €
Data sheet of TTYH1-tweety homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TTYH1-tweety homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019358 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TTYH1 |
| Origin species: | Human |
| Product name: | TTYH1-tweety homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC019358 |
| Gene id: | 57348 |
| Gene description: | tweety homolog 1 (Drosophila) |
| Synonyms: | protein tweety homolog 1; hTTY1; tweety homolog 1; tweety family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctggcctacgtcctcctgctgctcctggagctgctggtctgcctcttcaccctcctgggcctggcgaagcagagcaagtggctggtgatcgtgatgacagtcatgagtctcctggttctcgtcctgagctggggctccatgggcctggaggcagccacggccgtgggcctcagtgacttctgctccaatccagacccttatgttctgaacctgacccaggaggagacagggctcagctcagacatcctgagctattatctcctctgcaaccgggccgtctccaaccccttccaacagaggctgactctgtcccagcgagctctggccaacatccactcccagctgctgggcctggagcgagaagctgtgcctcagttcccttcagcgcagaagcctctgctgtccttggaggagactctgaatgtgacagaaggaaatttccaccagttggtggcactgctacactgccgcagcctgcacaaggactatggtgcagccctgcggggcctgtgcgaagacgccctggaaggcctgctcttcctgctgctcttctccctgctgtctgcaggagcgctggccactgccctctgcagcctgccccgagcctgggccctcttcccacccagtgacgactacgatgacacagacgatgacgaccctttcaaccctcagcaggaatccaagcgctttgtgcagtggcagtcgtctatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - unc-119 homolog (C. elegans) - kallikrein-related peptidase 6 - angel homolog 2 (Drosophila) - transmembrane protein 106A |