RPIA-ribose 5-phosphate isomerase A Gene View larger

RPIA-ribose 5-phosphate isomerase A Gene

PTXBC015529

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPIA-ribose 5-phosphate isomerase A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPIA-ribose 5-phosphate isomerase A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015529
Product type: DNA & cDNA
Ncbi symbol: RPIA
Origin species: Human
Product name: RPIA-ribose 5-phosphate isomerase A Gene
Size: 2ug
Accessions: BC015529
Gene id: 22934
Gene description: ribose 5-phosphate isomerase A
Synonyms: RPI; RPIAD; ribose-5-phosphate isomerase; phosphoriboisomerase; ribose 5-phosphate epimerase; ribose 5-phosphate isomerase A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaaggccgaggaggccaagaagctggcgggccgcgcggctgtggagaaccacgtgaggaataaccaagtgctgggaattggaagtggttctacaattgtccatgctgtgcagcgaatagctgaaagggtgaagcaagagaatctgaacctcgtctgtattcccacttccttccaggcccgccagctcatcctgcagtatggcttgaccctcagtgatctggatcgacacccagagatcgaccttgccatcgatggtgctgatgaagtagatgctgatctcaatctcatcaagggtggcggaggctgcctgacccaggagaagattgtggctggctatgctagtcgcttcatcgtgatcgctgatttcaggaaagattcgaagaatctcggggatcagtggcacaagggaatccccatcgaggtcatcccaatggcctatgtcccagtgagccgagctgtgagccagaagtttgggggcgtggttgaacttcgaatggctgtcaacaaggctggtcctgtggtgacagataatgggaattttatcttggactggaagtttgaccgggtacacaaatggagtgaagtgaatacagctatcaaaatgatcccaggtgtggtggacacaggcctattcatcaacatggctgagagagtctactttgggatgcaggatggctcagtgaacatgagggagaagcctttctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tweety homolog 1 (Drosophila)
- unc-119 homolog (C. elegans)
- kallikrein-related peptidase 6
- angel homolog 2 (Drosophila)

Buy RPIA-ribose 5-phosphate isomerase A Gene now

Add to cart