UBTD1-ubiquitin domain containing 1 Gene View larger

UBTD1-ubiquitin domain containing 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBTD1-ubiquitin domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UBTD1-ubiquitin domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007331
Product type: DNA & cDNA
Ncbi symbol: UBTD1
Origin species: Human
Product name: UBTD1-ubiquitin domain containing 1 Gene
Size: 2ug
Accessions: BC007331
Gene id: 80019
Gene description: ubiquitin domain containing 1
Synonyms: ubiquitin domain-containing protein 1; ubiquitin domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaactgcgtggggagacagcgccgggagaggccggcagccccgggacacccccgcaagcgagcaggacgcaatgagcccctgaagaaagagcggcttaagtggaagagcgactaccccatgactgacgggcagctgcggagcaaacgggatgagttctgggacacagcgcctgccttcgagggccgcaaggagatctgggatgccctcaaggctgccgcctatgctgctgaagccaacgaccacgagctggcccaggccatcctggatggagccagcatcaccctgcctcatggcaccctctgtgaatgctacgatgagctgggcaatcgctaccagctgcccatctactgcctgtcaccgccggtgaacctgctgctggagcacacggaggaggagagcctggagccccccgagcctccacccagcgtgcgccgtgagttcccgctgaaggtgcgcctgtccacgggcaaggacgtgaggctcagcgccagcctgcccgacacagtggggcagctcaagaggcagctgcacgcccaggagggcatcgagccatcgtggcagcggtggttcttctccgggaagctgctcacagaccgcacacggctccaggagaccaagatccagaaagattttgtcatccaggtcatcatcaaccagcccccaccaccccaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribose 5-phosphate isomerase A
- tweety homolog 1 (Drosophila)
- unc-119 homolog (C. elegans)
- kallikrein-related peptidase 6

Buy UBTD1-ubiquitin domain containing 1 Gene now

Add to cart