Login to display prices
Login to display prices
UBTD1-ubiquitin domain containing 1 Gene View larger

UBTD1-ubiquitin domain containing 1 Gene

PTXBC007331

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBTD1-ubiquitin domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBTD1-ubiquitin domain containing 1 Gene

Proteogenix catalog: PTXBC007331
Ncbi symbol: UBTD1
Product name: UBTD1-ubiquitin domain containing 1 Gene
Size: 2ug
Accessions: BC007331
Gene id: 80019
Gene description: ubiquitin domain containing 1
Synonyms: ubiquitin domain-containing protein 1; ubiquitin domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaactgcgtggggagacagcgccgggagaggccggcagccccgggacacccccgcaagcgagcaggacgcaatgagcccctgaagaaagagcggcttaagtggaagagcgactaccccatgactgacgggcagctgcggagcaaacgggatgagttctgggacacagcgcctgccttcgagggccgcaaggagatctgggatgccctcaaggctgccgcctatgctgctgaagccaacgaccacgagctggcccaggccatcctggatggagccagcatcaccctgcctcatggcaccctctgtgaatgctacgatgagctgggcaatcgctaccagctgcccatctactgcctgtcaccgccggtgaacctgctgctggagcacacggaggaggagagcctggagccccccgagcctccacccagcgtgcgccgtgagttcccgctgaaggtgcgcctgtccacgggcaaggacgtgaggctcagcgccagcctgcccgacacagtggggcagctcaagaggcagctgcacgcccaggagggcatcgagccatcgtggcagcggtggttcttctccgggaagctgctcacagaccgcacacggctccaggagaccaagatccagaaagattttgtcatccaggtcatcatcaaccagcccccaccaccccaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: