Login to display prices
Login to display prices
NPAL3-NIPA-like domain containing 3 Gene View larger

NPAL3-NIPA-like domain containing 3 Gene

PTXBC001265

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NPAL3-NIPA-like domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NPAL3-NIPA-like domain containing 3 Gene

Proteogenix catalog: PTXBC001265
Ncbi symbol: NPAL3
Product name: NPAL3-NIPA-like domain containing 3 Gene
Size: 2ug
Accessions: BC001265
Gene id: 57185
Gene description: NIPA-like domain containing 3
Synonyms: NPAL3; DJ462O23.2; NIPA-like protein 3; NIPA like domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggatcccacagcgcagccctgaagctgcagcagctgcctcccacaagtagctccagcgccgtaagcgaggcctccttctcctacaaggaaaacctgattggcgccctcttggcgatcttcgggcacctcgtggtcagcattgcacttaacctccagaagtactgccacatccgcctggcaggctccaaggatccccgggcctatttcaagaccaagacatggtggctgggcctgttcctgatgcttctgggcgagctgggtgtgttcgcctcctacgccttcgcgccgctgtcactcatcgtgcccctcagcgcagtttctgtgatagctagtgccatcataggaatcatattcatcaaggaaaagtggaaaccgaaagactttctgaggcgctacgtcttgtcctttgttggctgcggtttggctgtcgtgggtacctacctgctggtgacattcgcacccaacagtcacgagaagatgacaggcgagaatgtcaccaggcacctcgtgagctggcctttccttttgtacatgctggtggagatcattctgttctgcttgctgctctacttctacaaggagaagaacgccaacaacattgtcgtgattcttctcttggtggcgttacttgtcttgctctgtcacccaggctggagtgcagtggtacaatcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: