NPAL3-NIPA-like domain containing 3 Gene View larger

NPAL3-NIPA-like domain containing 3 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NPAL3-NIPA-like domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NPAL3-NIPA-like domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001265
Product type: DNA & cDNA
Ncbi symbol: NPAL3
Origin species: Human
Product name: NPAL3-NIPA-like domain containing 3 Gene
Size: 2ug
Accessions: BC001265
Gene id: 57185
Gene description: NIPA-like domain containing 3
Synonyms: NPAL3; DJ462O23.2; NIPA-like protein 3; NIPA like domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggatcccacagcgcagccctgaagctgcagcagctgcctcccacaagtagctccagcgccgtaagcgaggcctccttctcctacaaggaaaacctgattggcgccctcttggcgatcttcgggcacctcgtggtcagcattgcacttaacctccagaagtactgccacatccgcctggcaggctccaaggatccccgggcctatttcaagaccaagacatggtggctgggcctgttcctgatgcttctgggcgagctgggtgtgttcgcctcctacgccttcgcgccgctgtcactcatcgtgcccctcagcgcagtttctgtgatagctagtgccatcataggaatcatattcatcaaggaaaagtggaaaccgaaagactttctgaggcgctacgtcttgtcctttgttggctgcggtttggctgtcgtgggtacctacctgctggtgacattcgcacccaacagtcacgagaagatgacaggcgagaatgtcaccaggcacctcgtgagctggcctttccttttgtacatgctggtggagatcattctgttctgcttgctgctctacttctacaaggagaagaacgccaacaacattgtcgtgattcttctcttggtggcgttacttgtcttgctctgtcacccaggctggagtgcagtggtacaatcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitin domain containing 1
- ribose 5-phosphate isomerase A
- tweety homolog 1 (Drosophila)
- unc-119 homolog (C. elegans)

Buy NPAL3-NIPA-like domain containing 3 Gene now

Add to cart