TMEM125-transmembrane protein 125 Gene View larger

TMEM125-transmembrane protein 125 Gene

PTXBC016858

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM125-transmembrane protein 125 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM125-transmembrane protein 125 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016858
Product type: DNA & cDNA
Ncbi symbol: TMEM125
Origin species: Human
Product name: TMEM125-transmembrane protein 125 Gene
Size: 2ug
Accessions: BC016858
Gene id: 128218
Gene description: transmembrane protein 125
Synonyms: 6330530A05Rik; AV223516; transmembrane protein 125
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaacaggaggctcaagccccagggggccgggggctgcccccggacatgctggcagagcaggtggagctgtggtggtcccagcagccgcggcgctcggcgctctgcttcgtcgtggccgtgggcctcgtggcaggctgtggcgcgggcggcgtggcactgctgtcaaccaccagcagccgctcaggtgaatggcggctagcaacgggcactgtgctctgtttgctggctctgctggttctggtgaaacagctgatgagctcggctgtgcaggacatgaactgcatccgccaggcccaccatgtggccctgctgcgcagtggtggaggggccgacgccctcgtggtgctgctcagtggcctcgtgctgctggtcaccggcctgaccctggccgggctggccgccgcccctgcccctgctcggccgctggccgccatgctgtctgtgggcattgctctggctgccttgggctcgcttttgctgctgggcctgctgctgtatcaagtgggtgtgagcggacactgcccctccatctgtatggccactccctccacccacagtggccatggcggccatggcagcatcttcagcatctcaggacagttgtctgctggccggcgtcacgagaccacatccagcattgccagcctcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRELI domain containing 1
- transmembrane protein 86B
- Epstein-Barr virus induced 3
- exocyst complex component 7

Buy TMEM125-transmembrane protein 125 Gene now

Add to cart