GSTM4-glutathione S-transferase mu 4 Gene View larger

GSTM4-glutathione S-transferase mu 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTM4-glutathione S-transferase mu 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GSTM4-glutathione S-transferase mu 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015513
Product type: DNA & cDNA
Ncbi symbol: GSTM4
Origin species: Human
Product name: GSTM4-glutathione S-transferase mu 4 Gene
Size: 2ug
Accessions: BC015513
Gene id: 2948
Gene description: glutathione S-transferase mu 4
Synonyms: GSTM4-4; GTM4; glutathione S-transferase Mu 4; GST class-mu 4; GST-Mu2; GTS-Mu2; S-(hydroxyalkyl)glutathione lyase M4; glutathione S-alkyltransferase M4; glutathione S-aralkyltransferase M4; glutathione S-aryltransferase M4; glutathione S-transferase M4; testis tissue sperm-binding protein Li 60n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatgacactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctacgaggaaaagaagtatacgatgggggacgctcctgactatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctgccctacttgattgatggggctcacaagatcacccagagcaacgccatcctgtgctacattgcccgcaagcacaacctgtgtggggagacagaagaggagaagattcgtgtggacattttggagaaccaggctatggacgtctccaatcagctggccagagtctgctacagccctgactttgagaaactgaagccagaatacttggaggaacttcctacaatgatgcagcacttctcacagttcctggggaagaggccatggtttgttggagacaagatcacctttgtagatttcctcgcctatgatgtccttgacctccaccgtatatttgagcccaactgcttggacgccttcccaaatctgaaggacttcatctcccgctttgagggcttggagaagatctctgcctacatgaagtccagccgcttcctcccaaaacctctgtacacaagggtggctgtctggggcaacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP/GTP binding protein-like 2
- deafness, autosomal dominant 5
- neurogenic differentiation 1
- H2A histone family, member Y2

Buy GSTM4-glutathione S-transferase mu 4 Gene now

Add to cart