Login to display prices
Login to display prices
GSTM4-glutathione S-transferase mu 4 Gene View larger

GSTM4-glutathione S-transferase mu 4 Gene

PTXBC015513

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTM4-glutathione S-transferase mu 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTM4-glutathione S-transferase mu 4 Gene

Proteogenix catalog: PTXBC015513
Ncbi symbol: GSTM4
Product name: GSTM4-glutathione S-transferase mu 4 Gene
Size: 2ug
Accessions: BC015513
Gene id: 2948
Gene description: glutathione S-transferase mu 4
Synonyms: GSTM4-4; GTM4; glutathione S-transferase Mu 4; GST class-mu 4; GST-Mu2; GTS-Mu2; S-(hydroxyalkyl)glutathione lyase M4; glutathione S-alkyltransferase M4; glutathione S-aralkyltransferase M4; glutathione S-aryltransferase M4; glutathione S-transferase M4; testis tissue sperm-binding protein Li 60n
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatgacactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctacgaggaaaagaagtatacgatgggggacgctcctgactatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctgccctacttgattgatggggctcacaagatcacccagagcaacgccatcctgtgctacattgcccgcaagcacaacctgtgtggggagacagaagaggagaagattcgtgtggacattttggagaaccaggctatggacgtctccaatcagctggccagagtctgctacagccctgactttgagaaactgaagccagaatacttggaggaacttcctacaatgatgcagcacttctcacagttcctggggaagaggccatggtttgttggagacaagatcacctttgtagatttcctcgcctatgatgtccttgacctccaccgtatatttgagcccaactgcttggacgccttcccaaatctgaaggacttcatctcccgctttgagggcttggagaagatctctgcctacatgaagtccagccgcttcctcccaaaacctctgtacacaagggtggctgtctggggcaacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: