Login to display prices
Login to display prices
NHEDC1-Na+/H+ exchanger domain containing 1 Gene View larger

NHEDC1-Na+/H+ exchanger domain containing 1 Gene

PTXBC022079

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NHEDC1-Na+/H+ exchanger domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NHEDC1-Na+/H+ exchanger domain containing 1 Gene

Proteogenix catalog: PTXBC022079
Ncbi symbol: NHEDC1
Product name: NHEDC1-Na+/H+ exchanger domain containing 1 Gene
Size: 2ug
Accessions: BC022079
Gene id: 150159
Gene description: Na+/H+ exchanger domain containing 1
Synonyms: NHEDC1; NHA1; sodium/hydrogen exchanger 9B1; NHE domain-containing protein 1; Na(+)/H(+) exchanger-like domain-containing protein 1; sodium/hydrogen exchanger-like domain-containing protein 1; solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1; solute carrier family 9, subfamily B (cation proton antiporter 2), member 1; testicular tissue protein Li 127; solute carrier family 9 member B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttgagcatagtcttttcctcaggtgtggcctccgtctttcacccaggctggagtgtggtgtcacgatctcagctcactgcaaactctgcctcccgggttcaagtgattctcctccctcagcctcccgagtacctgggaccacaggtggtatacttaataacgccatagcctctataaggaacgtatgtattagtctgctggcaggaattgttttgggattttttgttcgatattttccaagtgaagaccagaaaaaacttacattgaagagaggattccttgttttgactatgtgtgtttctgccgtcttaggcagccaacgtattggtttacatggatctggaggattatgcacactagtgttgagtttcattgcagggacaaaatggtcccaagaaaagatgaaagtccaaaagattattacgactgtatgggatatttttcaaccacttctttttggtttagttggagcagaagtatctgtttcatcgcttgaatcaaatattgttggcatatctgttgccactctaagtttggcattatgtgttcgaattttaaccacatatctattgatgtgctttgctggttttagttttaaggagaaaatatttattgctttagcatggatgcccaaagctacagtacagagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: